RegRNA
A Regulatory RNA Motifs and Elements Finder
  Release 1.0, Jan 2006
 
 
 

Accession R0899
Feature Type Exonic Splicing RegRNA
Class Exon silencer
Name Exon silencer
Pattern TTAGGACGTATAGTTAGTCCTAGG
BindingProtein hnRNP A/B
References Bilodeau PS, Domsic JK, Mayeda A, Krainer AR, and Stoltzfus CM
RNA splicing at human immunodeficiency virus type 1 3` splice site A2 is regulated by binding of hnRNP A/B proteins to an exonic splicing silencer element.
J Virol 2001; 75(18), 8487-97   PubMed 


Department of Biological Science and Technology, Institute of Bioinformatics, National Chiao Tung University, Taiwan
Contact with Dr. Hsien-Da Huang