RegRNA
A Regulatory RNA Motifs and Elements Finder
  Release 1.0, Jan 2006
 
 
 

Accession R0883
Feature Type Exonic Splicing RegRNA
Class Exon enhancer
Name Exon enhancer
Pattern GGGGGGAAGCACACAGAGCCCAACGAGACCAC
BindingProtein SR protein
References Côté J, Simard MJ, and Chabot B
An element in the 5` common exon of the NCAM alternative splicing unit interacts with SR proteins and modulates 5` splice site selection.
Nucleic Acids Res 1999; 27(12), 2529-37   PubMed 


Department of Biological Science and Technology, Institute of Bioinformatics, National Chiao Tung University, Taiwan
Contact with Dr. Hsien-Da Huang