RegRNA
A Regulatory RNA Motifs and Elements Finder
  Release 1.0, Jan 2006
 
 
 

Accession R0863
Feature Type Exonic Splicing RegRNA
Class Exon silencer
Name Exon silencer
Pattern ATCGAGAAACCAGCAACGGAGCGGCGAATCGAC
BindingProtein SF2/ASF
References McNally LM, and McNally MT
SR protein splicing factors interact with the Rous sarcoma virus negative regulator of splicing element.
J Virol 1996; 70(2), 1163-72   PubMed 

McNally LM, and McNally MT
An RNA splicing enhancer-like sequence is a component of a splicing inhibitor element from Rous sarcoma virus.
Mol Cell Biol 1998; 18(6), 3103-11   PubMed 


Department of Biological Science and Technology, Institute of Bioinformatics, National Chiao Tung University, Taiwan
Contact with Dr. Hsien-Da Huang