RegRNA
A Regulatory RNA Motifs and Elements Finder
  Release 1.0, Jan 2006
 
 
 

Accession R0862
Feature Type Exonic Splicing RegRNA
Class Exon silencer
Name Exon silencer
Pattern CGAATCGACAAAGGGGAGGAAGTGGGAGAAA
BindingProtein HnRNP H
References Fogel BL, and McNally MT
A cellular protein, hnRNP H, binds to the negative regulator of splicing element from Rous sarcoma virus.
J Biol Chem 2000; 275(41), 32371-8   PubMed 


Department of Biological Science and Technology, Institute of Bioinformatics, National Chiao Tung University, Taiwan
Contact with Dr. Hsien-Da Huang