RegRNA
A Regulatory RNA Motifs and Elements Finder
  Release 1.0, Jan 2006
 
 
 

Accession R0856
Feature Type Exonic Splicing RegRNA
Class Exon silencer
Name Exon silencer
Pattern GTGACCCCTTACCTACTCACACCACTGCATTCTCACCCGCAAGCACCTTTG
BindingProtein
References Lynch KW, and Weiss A
A CD45 polymorphism associated with multiple sclerosis disrupts an exonic splicing silencer.
J Biol Chem 2001; 276(26), 24341-7   PubMed 


Department of Biological Science and Technology, Institute of Bioinformatics, National Chiao Tung University, Taiwan
Contact with Dr. Hsien-Da Huang