RegRNA
A Regulatory RNA Motifs and Elements Finder
  Release 1.0, Jan 2006
 
 
 

Accession R0851
Feature Type Exonic Splicing RegRNA
Class Exon enhancer
Name Exon enhancer
Pattern ACAAAGCGTTCTACCAGCAGCCAGATGCTG
BindingProtein
References Stamm S, Casper D, Dinsmore J, Kaufmann CA, Brosius J, and Helfman DM
Clathrin light chain B: gene structure and neuron-specific splicing.
Nucleic Acids Res 1992; 20(19), 5097-103   PubMed 


Department of Biological Science and Technology, Institute of Bioinformatics, National Chiao Tung University, Taiwan
Contact with Dr. Hsien-Da Huang