RegRNA
A Regulatory RNA Motifs and Elements Finder
  Release 1.0, Jan 2006
 
 
 

Accession R0850
Feature Type Exonic Splicing RegRNA
Class Exon silencer
Name Exon silencer
Pattern TCTTTAGGTTCCCTTTCAATTCT
BindingProtein PTB
References Le Guiner C, Plet A, Galiana D, Gesnel MC, Del Gatto-Konczak F, and Breathnach R
Polypyrimidine tract-binding protein represses splicing of a fibroblast growth factor receptor-2 gene alternative exon through exon sequences.
J Biol Chem 2001; 276(47), 43677-87   PubMed 


Department of Biological Science and Technology, Institute of Bioinformatics, National Chiao Tung University, Taiwan
Contact with Dr. Hsien-Da Huang