RegRNA
A Regulatory RNA Motifs and Elements Finder
  Release 1.0, Jan 2006
 
 
 

Accession R0848
Feature Type Exonic Splicing RegRNA
Class Exon enhancer
Name Exon enhancer
Pattern CACCCCGGTGACCTGCTGCAGCTTCGCTGTCGGCTGCGGGACGATGTGCAGAGCATCAACTGGCTGCGG
BindingProtein SRp55
References Jin W, Huang ES, Bi W, and Cote GJ
Exon sequence is required for regulated RNA splicing of the human fibroblast growth factor receptor-1 alpha-exon.
J Biol Chem 1998; 273(26), 16170-6   PubMed 


Department of Biological Science and Technology, Institute of Bioinformatics, National Chiao Tung University, Taiwan
Contact with Dr. Hsien-Da Huang