RegRNA
A Regulatory RNA Motifs and Elements Finder
  Release 1.0, Jan 2006
 
 
 

Accession R0845
Feature Type Exonic Splicing RegRNA
Class Exon enhancer
Name Exon enhancer
Pattern GAGGAAGAGAAAAGGGCAGCAGAGGAGAGGCA
BindingProtein
References Elrick LL, Humphrey MB, Cooper TA, and Berget SM
A short sequence within two purine-rich enhancers determines 5` splice site specificity.
Mol Cell Biol 1998; 18(1), 343-52   PubMed 


Department of Biological Science and Technology, Institute of Bioinformatics, National Chiao Tung University, Taiwan
Contact with Dr. Hsien-Da Huang