RegRNA
A Regulatory RNA Motifs and Elements Finder
  Release 1.0, Jan 2006
 
 
 

Accession R0838
Feature Type Exonic Splicing RegRNA
Class Exon enhancer
Name Exon enhancer
Pattern GAAGAAGAAGGTGGAGAGAGAGAGACAGAG
BindingProtein
References Amendt BA, Si ZH, and Stoltzfus CM
Presence of exon splicing silencers within human immunodeficiency virus type 1 tat exon 2 and tat-rev exon 3: evidence for inhibition mediated by cellular factors.
Mol Cell Biol 1995; 15(11), 6480   PubMed 


Department of Biological Science and Technology, Institute of Bioinformatics, National Chiao Tung University, Taiwan
Contact with Dr. Hsien-Da Huang