RegRNA
A Regulatory RNA Motifs and Elements Finder
  Release 1.0, Jan 2006
 
 
 

Accession R0830
Feature Type Exonic Splicing RegRNA
Class Exon enhancer
Name Exon enhancer
Pattern CTCCTATGGCAGGAAGAAGCGGAGACAGCGACGAAG
BindingProtein ASF/SF2
References Kammler S, Leurs C, Freund M, Krummheuer J, Seidel K, Tange TO, Lund MK, Kjems J, Scheid A, and Schaal H
The sequence complementarity between HIV-1 5` splice site SD4 and U1 snRNA determines the steady-state level of an unstable env pre-mRNA.
RNA 2001; 7(3), 421-34   PubMed 


Department of Biological Science and Technology, Institute of Bioinformatics, National Chiao Tung University, Taiwan
Contact with Dr. Hsien-Da Huang