RegRNA
A Regulatory RNA Motifs and Elements Finder
  Release 1.0, Jan 2006
 
 
 

Accession R0828
Feature Type Exonic Splicing RegRNA
Class Exon silencer
Name Exon silencer
Pattern TAAGTGTTCTGAGCTGGAGGAGGAGCTGAAGAATGTCACCAACAACCTCAAGTCTCTTGAGGCTCAGGCGGAGAAG
BindingProtein
References Graham IR, Hamshere M, and Eperon IC
Alternative splicing of a human alpha-tropomyosin muscle-specific exon: identification of determining sequences.
Mol Cell Biol 1992; 12(9), 3872-82   PubMed 


Department of Biological Science and Technology, Institute of Bioinformatics, National Chiao Tung University, Taiwan
Contact with Dr. Hsien-Da Huang