RegRNA
A Regulatory RNA Motifs and Elements Finder
  Release 1.0, Jan 2006
 
 
 

Accession R0813
Feature Type Exonic Splicing RegRNA
Class Exon enhancer
Name Exon enhancer
Pattern AAGAGGAAGAATGGCTTGAGGAAGACGACG
BindingProtein SRp55
References Nagel RJ, Lancaster AM, and Zahler AM
Specific binding of an exonic splicing enhancer by the pre-mRNA splicing factor SRp55.
RNA 1998; 4(1), 11-23   PubMed 


Department of Biological Science and Technology, Institute of Bioinformatics, National Chiao Tung University, Taiwan
Contact with Dr. Hsien-Da Huang