RegRNA
A Regulatory RNA Motifs and Elements Finder
  Release 1.0, Jan 2006
 
 
 

Accession R0637
Feature Type Exonic Splicing RegRNA
Class Exonic Splicing Sliencer
Name CD44 exonic splicing silencer
Pattern AGACAGAAUCAGCACCAGUGCUCAUGGAGAAAAUUGGACC
BindingProtein unknown
References K├Ânig H, Ponta H, and Herrlich P
Coupling of signal transduction to alternative pre-mRNA splicing by a composite splice regulator.
EMBO J 1998; 17(10), 2904-13   PubMed 


Department of Biological Science and Technology, Institute of Bioinformatics, National Chiao Tung University, Taiwan
Contact with Dr. Hsien-Da Huang