RegRNA
A Regulatory RNA Motifs and Elements Finder
  Release 1.0, Jan 2006
 
 
 

Accession R0632
Feature Type Exonic Splicing RegRNA
Class Exonic Splicing Sliencer
Name ESS3 in hnRNA A1 on Tat23 Pre-mRNA Splicing
Pattern AGAUCCAUUCGAUUAGUGAA
BindingProtein unknown
References Zhu J, Mayeda A, and Krainer AR
Exon identity established through differential antagonism between exonic splicing silencer-bound hnRNP A1 and enhancer-bound SR proteins.
Mol Cell 2001; 8(6), 1351-61   PubMed 


Department of Biological Science and Technology, Institute of Bioinformatics, National Chiao Tung University, Taiwan
Contact with Dr. Hsien-Da Huang