RegRNA
A Regulatory RNA Motifs and Elements Finder
  Release 1.0, Jan 2006
 
 
 

Accession R0627
Feature Type Exonic Splicing RegRNA
Class Exonic Splicing Sliencer
Name ESS-IgM pre-mRNA splicing inhibitor, human
Pattern CCTGTTGGCACGTGTTTCTCTTCCCCGCCCGGCCTCCAGAAGAGAGCTCTCACACAGGCTTCCTCTCGA
BindingProtein U2 snRNP
References Kan JL, and Green MR
Pre-mRNA splicing of IgM exons M1 and M2 is directed by a juxtaposed splicing enhancer and inhibitor.
Genes Dev 1999; 13(4), 462-71   PubMed 


Department of Biological Science and Technology, Institute of Bioinformatics, National Chiao Tung University, Taiwan
Contact with Dr. Hsien-Da Huang