RegRNA
A Regulatory RNA Motifs and Elements Finder
  Release 1.0, Jan 2006
 
 
 

Accession R0625
Feature Type Intronic Splicing RegRNA
Class Intronic Splicing Sliencer
Name ISS- Intronic splicing sequence bound by PTB
Pattern CUCCGCUCCUCCUCCAGGUAAGACU
BindingProtein PTB
References Wagner EJ, and Garcia-Blanco MA
Polypyrimidine tract binding protein antagonizes exon definition.
Mol Cell Biol 2001; 21(10), 3281-8   PubMed 


Department of Biological Science and Technology, Institute of Bioinformatics, National Chiao Tung University, Taiwan
Contact with Dr. Hsien-Da Huang