RegRNA
A Regulatory RNA Motifs and Elements Finder
  Release 1.0, Jan 2006
 
 
 

Accession R0200
Feature Type Transcriptional RegRNA
Name apoB (apolipoprotein B)
Target Region intron 2, enhancer
Pattern CTGTCCTGTTTATCAGTGACTAGTCATTGATTCGAAGCATGTGAGGGTGAGGAAATACTG ACTTTAACCTTTGTGAAGAAATCGAACCTCCACCCCC.
Species human, Homo sapiens
References Brooks AR, and Levy-Wilson B
Hepatocyte nuclear factor 1 and C/EBP are essential for the activity of the human apolipoprotein B gene second-intron enhancer.
Mol Cell Biol 1992; 12(3), 1134-48   PubMed 

Brooks AR, Blackhart BD, Haubold K, and Levy-Wilson B
Characterization of tissue-specific enhancer elements in the second intron of the human apolipoprotein B gene.
J Biol Chem 1991; 266(12), 7848-59   PubMed 


Department of Biological Science and Technology, Institute of Bioinformatics, National Chiao Tung University, Taiwan
Contact with Dr. Hsien-Da Huang