RegRNA
A Regulatory RNA Motifs and Elements Finder
  Release 1.0, Jan 2006
 
 
 

Accession R0179
Feature Type Transcriptional RegRNA
Name CRY-delta1 (delta1-crystallin)
Target Region intron III
Pattern AGTCAGCCACTAAGCACTTTTTCTGAAATATTCATTGTTGTTGCTCACCTACCAT.
Species chick, Gallus gallus
References Funahashi J, Kamachi Y, Goto K, and Kondoh H
Identification of nuclear factor delta EF1 and its binding site essential for lens-specific activity of the delta 1-crystallin enhancer.
Nucleic Acids Res 1991; 19(13), 3543-7   PubMed 


Department of Biological Science and Technology, Institute of Bioinformatics, National Chiao Tung University, Taiwan
Contact with Dr. Hsien-Da Huang