RegRNA
A Regulatory RNA Motifs and Elements Finder
  Release 1.0, Jan 2006
 
 
 

Accession R0018
Feature Type RegRNA in 5'-UTR
Name Ribosomal S12 mitochondrial protein 5'UTR translation control element (RPMS12_TCE)
Regulatory Motif
descr

        ss(seq="^CCGCGACCTCACCTTTAGGTCCTGTG$", mismatch=3)

Description Expression of RPMS12 gene, coding for a mitochondrial ribosomal S12 protein is controlled at level of transcription, splicing and translation in response to as yet unidentified signals mediating growth, tissue specificity and metabolic requirements.For this mRNA three splice variants of 5'UTR have been detected with only the shortest one found to be regulated by growth status. A 26 nt tract was found to be essential for post-transcriptional down-regulation, in growth-inhibited cells.
References Mariottini P, Shah ZH, Toivonen JM, Bagni C, Spelbrink JN, Amaldi F, and Jacobs HT
Expression of the gene for mitoribosomal protein S12 is controlled in human cells at the levels of transcription, RNA splicing, and translation.
J Biol Chem 1999; 274(45), 31853-62   PubMed 


Department of Biological Science and Technology, Institute of Bioinformatics, National Chiao Tung University, Taiwan
Contact with Dr. Hsien-Da Huang