RegRNA
A Regulatory RNA Motifs and Elements Finder
  Release 1.0, Jan 2006
 
 
 

Accession R0005
Feature Type RegRNA in 5'-UTR
Name Amyloid precursor protein mRNA stability control element (APP_SCE)
Regulatory Motif
UCUCUUUACAUUUUGGUCUCUAUACUACA[5,1,1]
Description Increased levels of Amyloid Precursor Protein (APP) expression are found in patients with Alzheimer's disease. APP mRNA stability is controlled by a 29-nt element in the 3-UTR of APP mRNA which has been found to interact with multiple cytosolic proteins. In resting cells, where no protein binding activity is detected, the 29-nt region acts in cis to destabilise APP mRNA (t1/2=4h). In mitogen activated peripheral blood mononuclear cells or cycling tumour cells the binding activity dramatically increases leading to APP stabilisation (t1/2>10h). The 29-nt element is highly conserved in mammals (see the alignment below) both in primary sequence and position about (200 nt from the stop codon). Human (Y00264) : UCUCUUUACAUUUUGGUCUCUAUACUACA Macaco(M58727) : ......................C...... Guinea Pig(X97631: ......................C...... Mouse (X59379) : ............C.........C.U.... Consensus : UCUCUUUACAUUYUGGUCUCUAYAYUACA
References Zaidi SH, and Malter JS
Amyloid precursor protein mRNA stability is controlled by a 29-base element in the 3 -untranslated region.
J Biol Chem 1994; 269(39), 24007-13   PubMed 


Department of Biological Science and Technology, Institute of Bioinformatics, National Chiao Tung University, Taiwan
Contact with Dr. Hsien-Da Huang