A Regulatory RNA Motifs and Elements Finder
  Release 1.0, Jan 2006

Regulatory Motif Classes
Regulatory RNA Motifs in UTR
Exonic Splicing Regulatory Motifs
Intronic Splicing Regulatory Motifs
Transcriptional Regulatory RNA Motifs
  2958 entries
MaturemiRNA ID MaturemiRNA Seq. miRNAprecursors ID miRNAprecursors Desc.
hsa-let-7a UGAGGUAGUAGGUUGUAUAGUU hsa-let-7a-1 Homo sapiens let-7a-1 stem-loop
hsa-let-7a-2 Homo sapiens let-7a-2 stem-loop
hsa-let-7a-3 Homo sapiens let-7a-3 stem-loop
hsa-let-7a* CUAUACAAUCUACUGUCUUUC hsa-let-7a-1 Homo sapiens let-7a-1 stem-loop
hsa-let-7a-3 Homo sapiens let-7a-3 stem-loop
hsa-let-7a-2* CUGUACAGCCUCCUAGCUUUCC hsa-let-7a-2 Homo sapiens let-7a-2 stem-loop
hsa-let-7b UGAGGUAGUAGGUUGUGUGGUU hsa-let-7b Homo sapiens let-7b stem-loop
hsa-let-7b* CUAUACAACCUACUGCCUUCCC hsa-let-7b Homo sapiens let-7b stem-loop
hsa-let-7c UGAGGUAGUAGGUUGUAUGGUU hsa-let-7c Homo sapiens let-7c stem-loop
hsa-let-7c* UAGAGUUACACCCUGGGAGUUA hsa-let-7c Homo sapiens let-7c stem-loop
hsa-let-7d AGAGGUAGUAGGUUGCAUAGUU hsa-let-7d Homo sapiens let-7d stem-loop
hsa-let-7d* CUAUACGACCUGCUGCCUUUCU hsa-let-7d Homo sapiens let-7d stem-loop
hsa-let-7e UGAGGUAGGAGGUUGUAUAGUU hsa-let-7e Homo sapiens let-7e stem-loop
hsa-let-7e* CUAUACGGCCUCCUAGCUUUCC hsa-let-7e Homo sapiens let-7e stem-loop
hsa-let-7f UGAGGUAGUAGAUUGUAUAGUU hsa-let-7f-1 Homo sapiens let-7f-1 stem-loop
hsa-let-7f-2 Homo sapiens let-7f-2 stem-loop
hsa-let-7f-1* CUAUACAAUCUAUUGCCUUCCC hsa-let-7f-1 Homo sapiens let-7f-1 stem-loop
hsa-let-7f-2* CUAUACAGUCUACUGUCUUUCC hsa-let-7f-2 Homo sapiens let-7f-2 stem-loop
hsa-let-7g UGAGGUAGUAGUUUGUACAGUU hsa-let-7g Homo sapiens let-7g stem-loop
hsa-let-7g* CUGUACAGGCCACUGCCUUGC hsa-let-7g Homo sapiens let-7g stem-loop
hsa-let-7i UGAGGUAGUAGUUUGUGCUGUU hsa-let-7i Homo sapiens let-7i stem-loop
hsa-let-7i* CUGCGCAAGCUACUGCCUUGCU hsa-let-7i Homo sapiens let-7i stem-loop
hsa-miR-1 UGGAAUGUAAAGAAGUAUGUAU hsa-mir-1-1 Homo sapiens miR-1-1 stem-loop
hsa-mir-1-2 Homo sapiens miR-1-2 stem-loop
hsa-miR-100 AACCCGUAGAUCCGAACUUGUG hsa-mir-100 Homo sapiens miR-100 stem-loop
hsa-miR-100* CAAGCUUGUAUCUAUAGGUAUG hsa-mir-100 Homo sapiens miR-100 stem-loop
hsa-miR-101* CAGUUAUCACAGUGCUGAUGCU hsa-mir-101-1 Homo sapiens miR-101-1 stem-loop
hsa-miR-101 UACAGUACUGUGAUAACUGAA hsa-mir-101-1 Homo sapiens miR-101-1 stem-loop
hsa-mir-101-2 Homo sapiens miR-101-2 stem-loop
hsa-miR-103 AGCAGCAUUGUACAGGGCUAUGA hsa-mir-103-1 Homo sapiens miR-103-1 stem-loop
hsa-mir-103-2 Homo sapiens miR-103-2 stem-loop
hsa-miR-103-as UCAUAGCCCUGUACAAUGCUGCU hsa-mir-103-1-as Homo sapiens miR-103-1-as stem-loop
hsa-mir-103-2-as Homo sapiens miR-103-2-as stem-loop
hsa-miR-103-2* AGCUUCUUUACAGUGCUGCCUUG hsa-mir-103-2 Homo sapiens miR-103-2 stem-loop
hsa-miR-105 UCAAAUGCUCAGACUCCUGUGGU hsa-mir-105-1 Homo sapiens miR-105-1 stem-loop
hsa-mir-105-2 Homo sapiens miR-105-2 stem-loop
hsa-miR-105* ACGGAUGUUUGAGCAUGUGCUA hsa-mir-105-1 Homo sapiens miR-105-1 stem-loop
hsa-mir-105-2 Homo sapiens miR-105-2 stem-loop
hsa-miR-106a AAAAGUGCUUACAGUGCAGGUAG hsa-mir-106a Homo sapiens miR-106a stem-loop
hsa-miR-106a* CUGCAAUGUAAGCACUUCUUAC hsa-mir-106a Homo sapiens miR-106a stem-loop
hsa-miR-106b UAAAGUGCUGACAGUGCAGAU hsa-mir-106b Homo sapiens miR-106b stem-loop
hsa-miR-106b* CCGCACUGUGGGUACUUGCUGC hsa-mir-106b Homo sapiens miR-106b stem-loop
hsa-miR-107 AGCAGCAUUGUACAGGGCUAUCA hsa-mir-107 Homo sapiens miR-107 stem-loop
hsa-miR-10a UACCCUGUAGAUCCGAAUUUGUG hsa-mir-10a Homo sapiens miR-10a stem-loop
hsa-miR-10a* CAAAUUCGUAUCUAGGGGAAUA hsa-mir-10a Homo sapiens miR-10a stem-loop
hsa-miR-10b UACCCUGUAGAACCGAAUUUGUG hsa-mir-10b Homo sapiens miR-10b stem-loop
hsa-miR-10b* ACAGAUUCGAUUCUAGGGGAAU hsa-mir-10b Homo sapiens miR-10b stem-loop
hsa-miR-1178 UUGCUCACUGUUCUUCCCUAG hsa-mir-1178 Homo sapiens miR-1178 stem-loop
hsa-miR-1179 AAGCAUUCUUUCAUUGGUUGG hsa-mir-1179 Homo sapiens miR-1179 stem-loop
hsa-miR-1180 UUUCCGGCUCGCGUGGGUGUGU hsa-mir-1180 Homo sapiens miR-1180 stem-loop
hsa-miR-1181 CCGUCGCCGCCACCCGAGCCG hsa-mir-1181 Homo sapiens miR-1181 stem-loop
hsa-miR-1182 GAGGGUCUUGGGAGGGAUGUGAC hsa-mir-1182 Homo sapiens miR-1182 stem-loop
hsa-miR-1183 CACUGUAGGUGAUGGUGAGAGUGGGCA hsa-mir-1183 Homo sapiens miR-1183 stem-loop
hsa-miR-1184 CCUGCAGCGACUUGAUGGCUUCC hsa-mir-1184-1 Homo sapiens miR-1184-1 stem-loop
hsa-mir-1184-2 Homo sapiens miR-1184-2 stem-loop
hsa-mir-1184-3 Homo sapiens miR-1184-3 stem-loop
hsa-miR-1185 AGAGGAUACCCUUUGUAUGUU hsa-mir-1185-1 Homo sapiens miR-1185-1 stem-loop
hsa-mir-1185-2 Homo sapiens miR-1185-2 stem-loop
hsa-miR-1193 GGGAUGGUAGACCGGUGACGUGC hsa-mir-1193 Homo sapiens miR-1193 stem-loop
hsa-miR-1197 UAGGACACAUGGUCUACUUCU hsa-mir-1197 Homo sapiens miR-1197 stem-loop
hsa-miR-1200 CUCCUGAGCCAUUCUGAGCCUC hsa-mir-1200 Homo sapiens miR-1200 stem-loop
hsa-miR-1202 GUGCCAGCUGCAGUGGGGGAG hsa-mir-1202 Homo sapiens miR-1202 stem-loop
hsa-miR-1203 CCCGGAGCCAGGAUGCAGCUC hsa-mir-1203 Homo sapiens miR-1203 stem-loop
hsa-miR-1204 UCGUGGCCUGGUCUCCAUUAU hsa-mir-1204 Homo sapiens miR-1204 stem-loop
hsa-miR-1205 UCUGCAGGGUUUGCUUUGAG hsa-mir-1205 Homo sapiens miR-1205 stem-loop
hsa-miR-1206 UGUUCAUGUAGAUGUUUAAGC hsa-mir-1206 Homo sapiens miR-1206 stem-loop
hsa-miR-1207-5p UGGCAGGGAGGCUGGGAGGGG hsa-mir-1207 Homo sapiens miR-1207 stem-loop
hsa-miR-1207-3p UCAGCUGGCCCUCAUUUC hsa-mir-1207 Homo sapiens miR-1207 stem-loop
hsa-miR-1208 UCACUGUUCAGACAGGCGGA hsa-mir-1208 Homo sapiens miR-1208 stem-loop
hsa-miR-122 UGGAGUGUGACAAUGGUGUUUG hsa-mir-122 Homo sapiens miR-122 stem-loop
hsa-miR-122* AACGCCAUUAUCACACUAAAUA hsa-mir-122 Homo sapiens miR-122 stem-loop
hsa-miR-1224-5p GUGAGGACUCGGGAGGUGG hsa-mir-1224 Homo sapiens mir-1224 stem-loop
hsa-miR-1224-3p CCCCACCUCCUCUCUCCUCAG hsa-mir-1224 Homo sapiens mir-1224 stem-loop
hsa-miR-1225-5p GUGGGUACGGCCCAGUGGGGGG hsa-mir-1225 Homo sapiens miR-1225 stem-loop
hsa-miR-1225-3p UGAGCCCCUGUGCCGCCCCCAG hsa-mir-1225 Homo sapiens miR-1225 stem-loop
hsa-miR-1226* GUGAGGGCAUGCAGGCCUGGAUGGGG hsa-mir-1226 Homo sapiens miR-1226 stem-loop
hsa-miR-1226 UCACCAGCCCUGUGUUCCCUAG hsa-mir-1226 Homo sapiens miR-1226 stem-loop
hsa-miR-1227 CGUGCCACCCUUUUCCCCAG hsa-mir-1227 Homo sapiens miR-1227 stem-loop
hsa-miR-1228* GUGGGCGGGGGCAGGUGUGUG hsa-mir-1228 Homo sapiens miR-1228 stem-loop
hsa-miR-1228 UCACACCUGCCUCGCCCCCC hsa-mir-1228 Homo sapiens miR-1228 stem-loop
hsa-miR-1229 CUCUCACCACUGCCCUCCCACAG hsa-mir-1229 Homo sapiens miR-1229 stem-loop
hsa-miR-1231 GUGUCUGGGCGGACAGCUGC hsa-mir-1231 Homo sapiens miR-1231 stem-loop
hsa-miR-1233 UGAGCCCUGUCCUCCCGCAG hsa-mir-1233-1 Homo sapiens miR-1233-1 stem-loop
hsa-mir-1233-2 Homo sapiens miR-1233-2 stem-loop
hsa-miR-1234 UCGGCCUGACCACCCACCCCAC hsa-mir-1234 Homo sapiens miR-1234 stem-loop
hsa-miR-1236 CCUCUUCCCCUUGUCUCUCCAG hsa-mir-1236 Homo sapiens miR-1236 stem-loop
hsa-miR-1237 UCCUUCUGCUCCGUCCCCCAG hsa-mir-1237 Homo sapiens miR-1237 stem-loop
hsa-miR-1238 CUUCCUCGUCUGUCUGCCCC hsa-mir-1238 Homo sapiens miR-1238 stem-loop
hsa-miR-124* CGUGUUCACAGCGGACCUUGAU hsa-mir-124-1 Homo sapiens miR-124-1 stem-loop
hsa-mir-124-2 Homo sapiens miR-124-2 stem-loop
hsa-mir-124-3 Homo sapiens miR-124-3 stem-loop
hsa-miR-124 UAAGGCACGCGGUGAAUGCC hsa-mir-124-1 Homo sapiens miR-124-1 stem-loop
hsa-mir-124-2 Homo sapiens miR-124-2 stem-loop
hsa-mir-124-3 Homo sapiens miR-124-3 stem-loop
hsa-miR-1243 AACUGGAUCAAUUAUAGGAGUG hsa-mir-1243 Homo sapiens miR-1243 stem-loop
hsa-miR-1244 AAGUAGUUGGUUUGUAUGAGAUGGUU hsa-mir-1244-1 Homo sapiens miR-1244-1 stem-loop
hsa-mir-1244-2 Homo sapiens miR-1244-2 stem-loop
hsa-mir-1244-3 Homo sapiens miR-1244-3 stem-loop
hsa-miR-1245 AAGUGAUCUAAAGGCCUACAU hsa-mir-1245 Homo sapiens miR-1245 stem-loop
hsa-miR-1246 AAUGGAUUUUUGGAGCAGG hsa-mir-1246 Homo sapiens miR-1246 stem-loop
hsa-miR-1247 ACCCGUCCCGUUCGUCCCCGGA hsa-mir-1247 Homo sapiens miR-1247 stem-loop
hsa-miR-1248 ACCUUCUUGUAUAAGCACUGUGCUAAA hsa-mir-1248 Homo sapiens miR-1248 stem-loop
hsa-miR-1249 ACGCCCUUCCCCCCCUUCUUCA hsa-mir-1249 Homo sapiens miR-1249 stem-loop
hsa-miR-1250 ACGGUGCUGGAUGUGGCCUUU hsa-mir-1250 Homo sapiens miR-1250 stem-loop
hsa-miR-1251 ACUCUAGCUGCCAAAGGCGCU hsa-mir-1251 Homo sapiens miR-1251 stem-loop
hsa-miR-1252 AGAAGGAAAUUGAAUUCAUUUA hsa-mir-1252 Homo sapiens miR-1252 stem-loop
hsa-miR-1253 AGAGAAGAAGAUCAGCCUGCA hsa-mir-1253 Homo sapiens miR-1253 stem-loop
hsa-miR-1254 AGCCUGGAAGCUGGAGCCUGCAGU hsa-mir-1254 Homo sapiens miR-1254 stem-loop
hsa-miR-1255a AGGAUGAGCAAAGAAAGUAGAUU hsa-mir-1255a Homo sapiens miR-1255a stem-loop
hsa-miR-1255b CGGAUGAGCAAAGAAAGUGGUU hsa-mir-1255b-1 Homo sapiens miR-1255b-1 stem-loop
hsa-mir-1255b-2 Homo sapiens miR-1255b-2 stem-loop
hsa-miR-1256 AGGCAUUGACUUCUCACUAGCU hsa-mir-1256 Homo sapiens miR-1256 stem-loop
hsa-miR-1257 AGUGAAUGAUGGGUUCUGACC hsa-mir-1257 Homo sapiens miR-1257 stem-loop
hsa-miR-1258 AGUUAGGAUUAGGUCGUGGAA hsa-mir-1258 Homo sapiens miR-1258 stem-loop
hsa-miR-125a-5p UCCCUGAGACCCUUUAACCUGUGA hsa-mir-125a Homo sapiens miR-125a stem-loop
hsa-miR-125a-3p ACAGGUGAGGUUCUUGGGAGCC hsa-mir-125a Homo sapiens miR-125a stem-loop
hsa-miR-125b UCCCUGAGACCCUAACUUGUGA hsa-mir-125b-1 Homo sapiens miR-125b-1 stem-loop
hsa-mir-125b-2 Homo sapiens miR-125b-2 stem-loop
hsa-miR-125b-1* ACGGGUUAGGCUCUUGGGAGCU hsa-mir-125b-1 Homo sapiens miR-125b-1 stem-loop
hsa-miR-125b-2* UCACAAGUCAGGCUCUUGGGAC hsa-mir-125b-2 Homo sapiens miR-125b-2 stem-loop
hsa-miR-126* CAUUAUUACUUUUGGUACGCG hsa-mir-126 Homo sapiens miR-126 stem-loop
hsa-miR-126 UCGUACCGUGAGUAAUAAUGCG hsa-mir-126 Homo sapiens miR-126 stem-loop
hsa-miR-1260 AUCCCACCUCUGCCACCA hsa-mir-1260 Homo sapiens miR-1260 stem-loop
hsa-miR-1260b AUCCCACCACUGCCACCAU hsa-mir-1260b Homo sapiens miR-1260b stem-loop
hsa-miR-1261 AUGGAUAAGGCUUUGGCUU hsa-mir-1261 Homo sapiens miR-1261 stem-loop
hsa-miR-1262 AUGGGUGAAUUUGUAGAAGGAU hsa-mir-1262 Homo sapiens miR-1262 stem-loop
hsa-miR-1263 AUGGUACCCUGGCAUACUGAGU hsa-mir-1263 Homo sapiens miR-1263 stem-loop
hsa-miR-1264 CAAGUCUUAUUUGAGCACCUGUU hsa-mir-1264 Homo sapiens miR-1264 stem-loop
hsa-miR-1265 CAGGAUGUGGUCAAGUGUUGUU hsa-mir-1265 Homo sapiens miR-1265 stem-loop
hsa-miR-1266 CCUCAGGGCUGUAGAACAGGGCU hsa-mir-1266 Homo sapiens miR-1266 stem-loop
hsa-miR-1267 CCUGUUGAAGUGUAAUCCCCA hsa-mir-1267 Homo sapiens miR-1267 stem-loop
hsa-miR-1268 CGGGCGUGGUGGUGGGGG hsa-mir-1268 Homo sapiens miR-1268 stem-loop
hsa-miR-1269 CUGGACUGAGCCGUGCUACUGG hsa-mir-1269 Homo sapiens miR-1269 stem-loop
hsa-miR-127-5p CUGAAGCUCAGAGGGCUCUGAU hsa-mir-127 Homo sapiens miR-127 stem-loop
hsa-miR-127-3p UCGGAUCCGUCUGAGCUUGGCU hsa-mir-127 Homo sapiens miR-127 stem-loop
hsa-miR-1270 CUGGAGAUAUGGAAGAGCUGUGU hsa-mir-1270-1 Homo sapiens miR-1270-1 stem-loop
hsa-mir-1270-2 Homo sapiens miR-1270-2 stem-loop
hsa-miR-1271 CUUGGCACCUAGCAAGCACUCA hsa-mir-1271 Homo sapiens miR-1271 stem-loop
hsa-miR-1272 GAUGAUGAUGGCAGCAAAUUCUGAAA hsa-mir-1272 Homo sapiens miR-1272 stem-loop
hsa-miR-1273 GGGCGACAAAGCAAGACUCUUUCUU hsa-mir-1273 Homo sapiens miR-1273 stem-loop
hsa-miR-1273c GGCGACAAAACGAGACCCUGUC hsa-mir-1273c Homo sapiens miR-1273c stem-loop
hsa-miR-1273d GAACCCAUGAGGUUGAGGCUGCAGU hsa-mir-1273d Homo sapiens miR-1273d stem-loop
hsa-miR-1273e UUGCUUGAACCCAGGAAGUGGA hsa-mir-1273e Homo sapiens miR-1273e stem-loop
hsa-miR-1274a GUCCCUGUUCAGGCGCCA hsa-mir-1274a Homo sapiens miR-1274a stem-loop
hsa-miR-1274b UCCCUGUUCGGGCGCCA hsa-mir-1274b Homo sapiens miR-1274b stem-loop
hsa-miR-1275 GUGGGGGAGAGGCUGUC hsa-mir-1275 Homo sapiens miR-1275 stem-loop
hsa-miR-1276 UAAAGAGCCCUGUGGAGACA hsa-mir-1276 Homo sapiens miR-1276 stem-loop
hsa-miR-1277 UACGUAGAUAUAUAUGUAUUUU hsa-mir-1277 Homo sapiens miR-1277 stem-loop
hsa-miR-1278 UAGUACUGUGCAUAUCAUCUAU hsa-mir-1278 Homo sapiens miR-1278 stem-loop
hsa-miR-1279 UCAUAUUGCUUCUUUCU hsa-mir-1279 Homo sapiens miR-1279 stem-loop
hsa-miR-128 UCACAGUGAACCGGUCUCUUU hsa-mir-128-1 Homo sapiens miR-128-1 stem-loop
hsa-mir-128-2 Homo sapiens miR-128-2 stem-loop
hsa-miR-1280 UCCCACCGCUGCCACCC hsa-mir-1280 Homo sapiens miR-1280 stem-loop
hsa-miR-1281 UCGCCUCCUCCUCUCCC hsa-mir-1281 Homo sapiens miR-1281 stem-loop
hsa-miR-1282 UCGUUUGCCUUUUUCUGCUU hsa-mir-1282 Homo sapiens miR-1282 stem-loop
hsa-miR-1283 UCUACAAAGGAAAGCGCUUUCU hsa-mir-1283-1 Homo sapiens miR-1283-1 stem-loop
hsa-mir-1283-2 Homo sapiens miR-1283-2 stem-loop
hsa-miR-1284 UCUAUACAGACCCUGGCUUUUC hsa-mir-1284 Homo sapiens miR-1284 stem-loop
hsa-miR-1285 UCUGGGCAACAAAGUGAGACCU hsa-mir-1285-1 Homo sapiens miR-1285-1 stem-loop
hsa-mir-1285-2 Homo sapiens miR-1285-2 stem-loop
hsa-miR-1286 UGCAGGACCAAGAUGAGCCCU hsa-mir-1286 Homo sapiens miR-1286 stem-loop
hsa-miR-1287 UGCUGGAUCAGUGGUUCGAGUC hsa-mir-1287 Homo sapiens miR-1287 stem-loop
hsa-miR-1288 UGGACUGCCCUGAUCUGGAGA hsa-mir-1288 Homo sapiens miR-1288 stem-loop
hsa-miR-1289 UGGAGUCCAGGAAUCUGCAUUUU hsa-mir-1289-1 Homo sapiens miR-1289-1 stem-loop
hsa-mir-1289-2 Homo sapiens miR-1289-2 stem-loop
hsa-miR-129-5p CUUUUUGCGGUCUGGGCUUGC hsa-mir-129-1 Homo sapiens miR-129-1 stem-loop
hsa-mir-129-2 Homo sapiens miR-129-2 stem-loop
hsa-miR-129* AAGCCCUUACCCCAAAAAGUAU hsa-mir-129-1 Homo sapiens miR-129-1 stem-loop
hsa-miR-129-3p AAGCCCUUACCCCAAAAAGCAU hsa-mir-129-2 Homo sapiens miR-129-2 stem-loop
hsa-miR-1290 UGGAUUUUUGGAUCAGGGA hsa-mir-1290 Homo sapiens miR-1290 stem-loop
hsa-miR-1291 UGGCCCUGACUGAAGACCAGCAGU hsa-mir-1291 Homo sapiens miR-1291 stem-loop
hsa-miR-1292 UGGGAACGGGUUCCGGCAGACGCUG hsa-mir-1292 Homo sapiens miR-1292 stem-loop
hsa-miR-1293 UGGGUGGUCUGGAGAUUUGUGC hsa-mir-1293 Homo sapiens miR-1293 stem-loop
hsa-miR-1294 UGUGAGGUUGGCAUUGUUGUCU hsa-mir-1294 Homo sapiens miR-1294 stem-loop
hsa-miR-1295 UUAGGCCGCAGAUCUGGGUGA hsa-mir-1295 Homo sapiens miR-1295 stem-loop
hsa-miR-1296 UUAGGGCCCUGGCUCCAUCUCC hsa-mir-1296 Homo sapiens miR-1296 stem-loop
hsa-miR-1297 UUCAAGUAAUUCAGGUG hsa-mir-1297 Homo sapiens miR-1297 stem-loop
hsa-miR-1298 UUCAUUCGGCUGUCCAGAUGUA hsa-mir-1298 Homo sapiens miR-1298 stem-loop
hsa-miR-1299 UUCUGGAAUUCUGUGUGAGGGA hsa-mir-1299 Homo sapiens miR-1299 stem-loop
hsa-miR-1301 UUGCAGCUGCCUGGGAGUGACUUC hsa-mir-1301 Homo sapiens miR-1301 stem-loop
hsa-miR-1302 UUGGGACAUACUUAUGCUAAA hsa-mir-1302-1 Homo sapiens miR-1302-1 stem-loop
hsa-mir-1302-10 Homo sapiens miR-1302-10 stem-loop
hsa-mir-1302-11 Homo sapiens miR-1302-11 stem-loop
hsa-mir-1302-2 Homo sapiens miR-1302-2 stem-loop
hsa-mir-1302-3 Homo sapiens miR-1302-3 stem-loop
hsa-mir-1302-4 Homo sapiens miR-1302-4 stem-loop
hsa-mir-1302-5 Homo sapiens miR-1302-5 stem-loop
hsa-mir-1302-6 Homo sapiens miR-1302-6 stem-loop
hsa-mir-1302-7 Homo sapiens miR-1302-7 stem-loop
hsa-mir-1302-8 Homo sapiens miR-1302-8 stem-loop
hsa-mir-1302-9 Homo sapiens miR-1302-9 stem-loop
hsa-miR-1303 UUUAGAGACGGGGUCUUGCUCU hsa-mir-1303 Homo sapiens miR-1303 stem-loop
hsa-miR-1304 UUUGAGGCUACAGUGAGAUGUG hsa-mir-1304 Homo sapiens miR-1304 stem-loop
hsa-miR-1305 UUUUCAACUCUAAUGGGAGAGA hsa-mir-1305 Homo sapiens miR-1305 stem-loop
hsa-miR-1306 ACGUUGGCUCUGGUGGUG hsa-mir-1306 Homo sapiens miR-1306 stem-loop
hsa-miR-1307 ACUCGGCGUGGCGUCGGUCGUG hsa-mir-1307 Homo sapiens miR-1307 stem-loop
hsa-miR-130a* UUCACAUUGUGCUACUGUCUGC hsa-mir-130a Homo sapiens miR-130a stem-loop
hsa-miR-130a CAGUGCAAUGUUAAAAGGGCAU hsa-mir-130a Homo sapiens miR-130a stem-loop
hsa-miR-130b* ACUCUUUCCCUGUUGCACUAC hsa-mir-130b Homo sapiens miR-130b stem-loop
hsa-miR-130b CAGUGCAAUGAUGAAAGGGCAU hsa-mir-130b Homo sapiens miR-130b stem-loop
hsa-miR-132* ACCGUGGCUUUCGAUUGUUACU hsa-mir-132 Homo sapiens miR-132 stem-loop
hsa-miR-132 UAACAGUCUACAGCCAUGGUCG hsa-mir-132 Homo sapiens miR-132 stem-loop
hsa-miR-1321 CAGGGAGGUGAAUGUGAU hsa-mir-1321 Homo sapiens miR-1321 stem-loop
hsa-miR-1322 GAUGAUGCUGCUGAUGCUG hsa-mir-1322 Homo sapiens miR-1322 stem-loop
hsa-miR-1323 UCAAAACUGAGGGGCAUUUUCU hsa-mir-1323 Homo sapiens miR-1323 stem-loop
hsa-miR-1324 CCAGACAGAAUUCUAUGCACUUUC hsa-mir-1324 Homo sapiens miR-1324 stem-loop
hsa-miR-133a UUUGGUCCCCUUCAACCAGCUG hsa-mir-133a-1 Homo sapiens miR-133a-1 stem-loop
hsa-mir-133a-2 Homo sapiens miR-133a-2 stem-loop
hsa-miR-133b UUUGGUCCCCUUCAACCAGCUA hsa-mir-133b Homo sapiens miR-133b stem-loop
hsa-miR-134 UGUGACUGGUUGACCAGAGGGG hsa-mir-134 Homo sapiens miR-134 stem-loop
hsa-miR-135a UAUGGCUUUUUAUUCCUAUGUGA hsa-mir-135a-1 Homo sapiens miR-135a-1 stem-loop
hsa-mir-135a-2 Homo sapiens miR-135a-2 stem-loop
hsa-miR-135a* UAUAGGGAUUGGAGCCGUGGCG hsa-mir-135a-1 Homo sapiens miR-135a-1 stem-loop
hsa-miR-135b UAUGGCUUUUCAUUCCUAUGUGA hsa-mir-135b Homo sapiens miR-135b stem-loop
hsa-miR-135b* AUGUAGGGCUAAAAGCCAUGGG hsa-mir-135b Homo sapiens miR-135b stem-loop
hsa-miR-136 ACUCCAUUUGUUUUGAUGAUGGA hsa-mir-136 Homo sapiens miR-136 stem-loop
hsa-miR-136* CAUCAUCGUCUCAAAUGAGUCU hsa-mir-136 Homo sapiens miR-136 stem-loop
hsa-miR-137 UUAUUGCUUAAGAAUACGCGUAG hsa-mir-137 Homo sapiens miR-137 stem-loop
hsa-miR-138 AGCUGGUGUUGUGAAUCAGGCCG hsa-mir-138-1 Homo sapiens miR-138-1 stem-loop
hsa-mir-138-2 Homo sapiens miR-138-2 stem-loop
hsa-miR-138-1* GCUACUUCACAACACCAGGGCC hsa-mir-138-1 Homo sapiens miR-138-1 stem-loop
hsa-miR-138-2* GCUAUUUCACGACACCAGGGUU hsa-mir-138-2 Homo sapiens miR-138-2 stem-loop
hsa-miR-139-5p UCUACAGUGCACGUGUCUCCAG hsa-mir-139 Homo sapiens miR-139 stem-loop
hsa-miR-139-3p GGAGACGCGGCCCUGUUGGAGU hsa-mir-139 Homo sapiens miR-139 stem-loop
hsa-miR-140-5p CAGUGGUUUUACCCUAUGGUAG hsa-mir-140 Homo sapiens miR-140 stem-loop
hsa-miR-140-3p UACCACAGGGUAGAACCACGG hsa-mir-140 Homo sapiens miR-140 stem-loop
hsa-miR-141* CAUCUUCCAGUACAGUGUUGGA hsa-mir-141 Homo sapiens miR-141 stem-loop
hsa-miR-141 UAACACUGUCUGGUAAAGAUGG hsa-mir-141 Homo sapiens miR-141 stem-loop
hsa-miR-142-5p CAUAAAGUAGAAAGCACUACU hsa-mir-142 Homo sapiens miR-142 stem-loop
hsa-miR-142-3p UGUAGUGUUUCCUACUUUAUGGA hsa-mir-142 Homo sapiens miR-142 stem-loop
hsa-miR-143* GGUGCAGUGCUGCAUCUCUGGU hsa-mir-143 Homo sapiens miR-143 stem-loop
hsa-miR-143 UGAGAUGAAGCACUGUAGCUC hsa-mir-143 Homo sapiens miR-143 stem-loop
hsa-miR-144* GGAUAUCAUCAUAUACUGUAAG hsa-mir-144 Homo sapiens miR-144 stem-loop
hsa-miR-144 UACAGUAUAGAUGAUGUACU hsa-mir-144 Homo sapiens miR-144 stem-loop
hsa-miR-145 GUCCAGUUUUCCCAGGAAUCCCU hsa-mir-145 Homo sapiens miR-145 stem-loop
hsa-miR-145* GGAUUCCUGGAAAUACUGUUCU hsa-mir-145 Homo sapiens miR-145 stem-loop
hsa-miR-1468 CUCCGUUUGCCUGUUUCGCUG hsa-mir-1468 Homo sapiens mir-1468 stem-loop
hsa-miR-1469 CUCGGCGCGGGGCGCGGGCUCC hsa-mir-1469 Homo sapiens miR-1469 stem-loop
hsa-miR-146a UGAGAACUGAAUUCCAUGGGUU hsa-mir-146a Homo sapiens miR-146a stem-loop
hsa-miR-146a* CCUCUGAAAUUCAGUUCUUCAG hsa-mir-146a Homo sapiens miR-146a stem-loop
hsa-miR-146b-5p UGAGAACUGAAUUCCAUAGGCU hsa-mir-146b Homo sapiens miR-146b stem-loop
hsa-miR-146b-3p UGCCCUGUGGACUCAGUUCUGG hsa-mir-146b Homo sapiens miR-146b stem-loop
hsa-miR-147 GUGUGUGGAAAUGCUUCUGC hsa-mir-147 Homo sapiens miR-147 stem-loop
hsa-miR-1470 GCCCUCCGCCCGUGCACCCCG hsa-mir-1470 Homo sapiens miR-1470 stem-loop
hsa-miR-1471 GCCCGCGUGUGGAGCCAGGUGU hsa-mir-1471 Homo sapiens miR-1471 stem-loop
hsa-miR-147b GUGUGCGGAAAUGCUUCUGCUA hsa-mir-147b Homo sapiens miR-147b stem-loop
hsa-miR-148a* AAAGUUCUGAGACACUCCGACU hsa-mir-148a Homo sapiens miR-148a stem-loop
hsa-miR-148a UCAGUGCACUACAGAACUUUGU hsa-mir-148a Homo sapiens miR-148a stem-loop
hsa-miR-148b* AAGUUCUGUUAUACACUCAGGC hsa-mir-148b Homo sapiens miR-148b stem-loop
hsa-miR-148b UCAGUGCAUCACAGAACUUUGU hsa-mir-148b Homo sapiens miR-148b stem-loop
hsa-miR-149 UCUGGCUCCGUGUCUUCACUCCC hsa-mir-149 Homo sapiens miR-149 stem-loop
hsa-miR-149* AGGGAGGGACGGGGGCUGUGC hsa-mir-149 Homo sapiens miR-149 stem-loop
hsa-miR-150 UCUCCCAACCCUUGUACCAGUG hsa-mir-150 Homo sapiens miR-150 stem-loop
hsa-miR-150* CUGGUACAGGCCUGGGGGACAG hsa-mir-150 Homo sapiens miR-150 stem-loop
hsa-miR-151-5p UCGAGGAGCUCACAGUCUAGU hsa-mir-151 Homo sapiens miR-151 stem-loop
hsa-miR-151-3p CUAGACUGAAGCUCCUUGAGG hsa-mir-151 Homo sapiens miR-151 stem-loop
hsa-miR-152 UCAGUGCAUGACAGAACUUGG hsa-mir-152 Homo sapiens miR-152 stem-loop
hsa-miR-153 UUGCAUAGUCACAAAAGUGAUC hsa-mir-153-1 Homo sapiens miR-153-1 stem-loop
hsa-mir-153-2 Homo sapiens miR-153-2 stem-loop
hsa-miR-1537 AAAACCGUCUAGUUACAGUUGU hsa-mir-1537 Homo sapiens miR-1537 stem-loop
hsa-miR-1538 CGGCCCGGGCUGCUGCUGUUCCU hsa-mir-1538 Homo sapiens miR-1538 stem-loop
hsa-miR-1539 UCCUGCGCGUCCCAGAUGCCC hsa-mir-1539 Homo sapiens miR-1539 stem-loop
hsa-miR-154 UAGGUUAUCCGUGUUGCCUUCG hsa-mir-154 Homo sapiens miR-154 stem-loop
hsa-miR-154* AAUCAUACACGGUUGACCUAUU hsa-mir-154 Homo sapiens miR-154 stem-loop
hsa-miR-155 UUAAUGCUAAUCGUGAUAGGGGU hsa-mir-155 Homo sapiens miR-155 stem-loop
hsa-miR-155* CUCCUACAUAUUAGCAUUAACA hsa-mir-155 Homo sapiens miR-155 stem-loop
hsa-miR-15a UAGCAGCACAUAAUGGUUUGUG hsa-mir-15a Homo sapiens miR-15a stem-loop
hsa-miR-15a* CAGGCCAUAUUGUGCUGCCUCA hsa-mir-15a Homo sapiens miR-15a stem-loop
hsa-miR-15b UAGCAGCACAUCAUGGUUUACA hsa-mir-15b Homo sapiens miR-15b stem-loop
hsa-miR-15b* CGAAUCAUUAUUUGCUGCUCUA hsa-mir-15b Homo sapiens miR-15b stem-loop
hsa-miR-16 UAGCAGCACGUAAAUAUUGGCG hsa-mir-16-1 Homo sapiens miR-16-1 stem-loop
hsa-mir-16-2 Homo sapiens miR-16-2 stem-loop
hsa-miR-16-1* CCAGUAUUAACUGUGCUGCUGA hsa-mir-16-1 Homo sapiens miR-16-1 stem-loop
hsa-miR-16-2* CCAAUAUUACUGUGCUGCUUUA hsa-mir-16-2 Homo sapiens miR-16-2 stem-loop
hsa-miR-17 CAAAGUGCUUACAGUGCAGGUAG hsa-mir-17 Homo sapiens miR-17 stem-loop
hsa-miR-17* ACUGCAGUGAAGGCACUUGUAG hsa-mir-17 Homo sapiens miR-17 stem-loop
hsa-miR-181a AACAUUCAACGCUGUCGGUGAGU hsa-mir-181a-1 Homo sapiens miR-181a-1 stem-loop
hsa-mir-181a-2 Homo sapiens mir-181a-2 stem-loop
hsa-miR-181a* ACCAUCGACCGUUGAUUGUACC hsa-mir-181a-1 Homo sapiens miR-181a-1 stem-loop
hsa-miR-181a-2* ACCACUGACCGUUGACUGUACC hsa-mir-181a-2 Homo sapiens mir-181a-2 stem-loop
hsa-miR-181b AACAUUCAUUGCUGUCGGUGGGU hsa-mir-181b-1 Homo sapiens miR-181b-1 stem-loop
hsa-mir-181b-2 Homo sapiens miR-181b-2 stem-loop
hsa-miR-181c AACAUUCAACCUGUCGGUGAGU hsa-mir-181c Homo sapiens miR-181c stem-loop
hsa-miR-181c* AACCAUCGACCGUUGAGUGGAC hsa-mir-181c Homo sapiens miR-181c stem-loop
hsa-miR-181d AACAUUCAUUGUUGUCGGUGGGU hsa-mir-181d Homo sapiens miR-181d stem-loop
hsa-miR-182 UUUGGCAAUGGUAGAACUCACACU hsa-mir-182 Homo sapiens miR-182 stem-loop
hsa-miR-182* UGGUUCUAGACUUGCCAACUA hsa-mir-182 Homo sapiens miR-182 stem-loop
hsa-miR-1825 UCCAGUGCCCUCCUCUCC hsa-mir-1825 Homo sapiens miR-1825 stem-loop
hsa-miR-1827 UGAGGCAGUAGAUUGAAU hsa-mir-1827 Homo sapiens miR-1827 stem-loop
hsa-miR-183 UAUGGCACUGGUAGAAUUCACU hsa-mir-183 Homo sapiens miR-183 stem-loop
hsa-miR-183* GUGAAUUACCGAAGGGCCAUAA hsa-mir-183 Homo sapiens miR-183 stem-loop
hsa-miR-184 UGGACGGAGAACUGAUAAGGGU hsa-mir-184 Homo sapiens miR-184 stem-loop
hsa-miR-185 UGGAGAGAAAGGCAGUUCCUGA hsa-mir-185 Homo sapiens miR-185 stem-loop
hsa-miR-185* AGGGGCUGGCUUUCCUCUGGUC hsa-mir-185 Homo sapiens miR-185 stem-loop
hsa-miR-186 CAAAGAAUUCUCCUUUUGGGCU hsa-mir-186 Homo sapiens miR-186 stem-loop
hsa-miR-186* GCCCAAAGGUGAAUUUUUUGGG hsa-mir-186 Homo sapiens miR-186 stem-loop
hsa-miR-187* GGCUACAACACAGGACCCGGGC hsa-mir-187 Homo sapiens miR-187 stem-loop
hsa-miR-187 UCGUGUCUUGUGUUGCAGCCGG hsa-mir-187 Homo sapiens miR-187 stem-loop
hsa-miR-188-5p CAUCCCUUGCAUGGUGGAGGG hsa-mir-188 Homo sapiens miR-188 stem-loop
hsa-miR-188-3p CUCCCACAUGCAGGGUUUGCA hsa-mir-188 Homo sapiens miR-188 stem-loop
hsa-miR-18a UAAGGUGCAUCUAGUGCAGAUAG hsa-mir-18a Homo sapiens miR-18a stem-loop
hsa-miR-18a* ACUGCCCUAAGUGCUCCUUCUGG hsa-mir-18a Homo sapiens miR-18a stem-loop
hsa-miR-18b UAAGGUGCAUCUAGUGCAGUUAG hsa-mir-18b Homo sapiens miR-18b stem-loop
hsa-miR-18b* UGCCCUAAAUGCCCCUUCUGGC hsa-mir-18b Homo sapiens miR-18b stem-loop
hsa-miR-190 UGAUAUGUUUGAUAUAUUAGGU hsa-mir-190 Homo sapiens miR-190 stem-loop
hsa-miR-1908 CGGCGGGGACGGCGAUUGGUC hsa-mir-1908 Homo sapiens miR-1908 stem-loop
hsa-miR-1909* UGAGUGCCGGUGCCUGCCCUG hsa-mir-1909 Homo sapiens miR-1909 stem-loop
hsa-miR-1909 CGCAGGGGCCGGGUGCUCACCG hsa-mir-1909 Homo sapiens miR-1909 stem-loop
hsa-miR-190b UGAUAUGUUUGAUAUUGGGUU hsa-mir-190b Homo sapiens miR-190b stem-loop
hsa-miR-191 CAACGGAAUCCCAAAAGCAGCUG hsa-mir-191 Homo sapiens miR-191 stem-loop
hsa-miR-191* GCUGCGCUUGGAUUUCGUCCCC hsa-mir-191 Homo sapiens miR-191 stem-loop
hsa-miR-1910 CCAGUCCUGUGCCUGCCGCCU hsa-mir-1910 Homo sapiens miR-1910 stem-loop
hsa-miR-1911 UGAGUACCGCCAUGUCUGUUGGG hsa-mir-1911 Homo sapiens miR-1911 stem-loop
hsa-miR-1911* CACCAGGCAUUGUGGUCUCC hsa-mir-1911 Homo sapiens miR-1911 stem-loop
hsa-miR-1912 UACCCAGAGCAUGCAGUGUGAA hsa-mir-1912 Homo sapiens miR-1912 stem-loop
hsa-miR-1913 UCUGCCCCCUCCGCUGCUGCCA hsa-mir-1913 Homo sapiens miR-1913 stem-loop
hsa-miR-1914 CCCUGUGCCCGGCCCACUUCUG hsa-mir-1914 Homo sapiens miR-1914 stem-loop
hsa-miR-1914* GGAGGGGUCCCGCACUGGGAGG hsa-mir-1914 Homo sapiens miR-1914 stem-loop
hsa-miR-1915* ACCUUGCCUUGCUGCCCGGGCC hsa-mir-1915 Homo sapiens miR-1915 stem-loop
hsa-miR-1915 CCCCAGGGCGACGCGGCGGG hsa-mir-1915 Homo sapiens miR-1915 stem-loop
hsa-miR-192 CUGACCUAUGAAUUGACAGCC hsa-mir-192 Homo sapiens miR-192 stem-loop
hsa-miR-192* CUGCCAAUUCCAUAGGUCACAG hsa-mir-192 Homo sapiens miR-192 stem-loop
hsa-miR-193a-5p UGGGUCUUUGCGGGCGAGAUGA hsa-mir-193a Homo sapiens miR-193a stem-loop
hsa-miR-193a-3p AACUGGCCUACAAAGUCCCAGU hsa-mir-193a Homo sapiens miR-193a stem-loop
hsa-miR-193b* CGGGGUUUUGAGGGCGAGAUGA hsa-mir-193b Homo sapiens miR-193b stem-loop
hsa-miR-193b AACUGGCCCUCAAAGUCCCGCU hsa-mir-193b Homo sapiens miR-193b stem-loop
hsa-miR-194 UGUAACAGCAACUCCAUGUGGA hsa-mir-194-1 Homo sapiens miR-194-1 stem-loop
hsa-mir-194-2 Homo sapiens miR-194-2 stem-loop
hsa-miR-194* CCAGUGGGGCUGCUGUUAUCUG hsa-mir-194-2 Homo sapiens miR-194-2 stem-loop
hsa-miR-195 UAGCAGCACAGAAAUAUUGGC hsa-mir-195 Homo sapiens miR-195 stem-loop
hsa-miR-195* CCAAUAUUGGCUGUGCUGCUCC hsa-mir-195 Homo sapiens miR-195 stem-loop
hsa-miR-196a UAGGUAGUUUCAUGUUGUUGGG hsa-mir-196a-1 Homo sapiens miR-196a-1 stem-loop
hsa-mir-196a-2 Homo sapiens miR-196a-2 stem-loop
hsa-miR-196a* CGGCAACAAGAAACUGCCUGAG hsa-mir-196a-2 Homo sapiens miR-196a-2 stem-loop
hsa-miR-196b UAGGUAGUUUCCUGUUGUUGGG hsa-mir-196b Homo sapiens miR-196b stem-loop
hsa-miR-196b* UCGACAGCACGACACUGCCUUC hsa-mir-196b Homo sapiens miR-196b stem-loop
hsa-miR-197 UUCACCACCUUCUCCACCCAGC hsa-mir-197 Homo sapiens miR-197 stem-loop
hsa-miR-1972 UCAGGCCAGGCACAGUGGCUCA hsa-mir-1972-1 Homo sapiens miR-1972-1 stem-loop
hsa-mir-1972-2 Homo sapiens miR-1972-2 stem-loop
hsa-miR-1973 ACCGUGCAAAGGUAGCAUA hsa-mir-1973 Homo sapiens miR-1973 stem-loop
hsa-miR-1976 CCUCCUGCCCUCCUUGCUGU hsa-mir-1976 Homo sapiens miR-1976 stem-loop
hsa-miR-198 GGUCCAGAGGGGAGAUAGGUUC hsa-mir-198 Homo sapiens miR-198 stem-loop
hsa-miR-199a-5p CCCAGUGUUCAGACUACCUGUUC hsa-mir-199a-1 Homo sapiens miR-199a-1 stem-loop
hsa-mir-199a-2 Homo sapiens miR-199a-2 stem-loop
hsa-miR-199a-3p ACAGUAGUCUGCACAUUGGUUA hsa-mir-199a-1 Homo sapiens miR-199a-1 stem-loop
hsa-mir-199a-2 Homo sapiens miR-199a-2 stem-loop
hsa-miR-199b-5p CCCAGUGUUUAGACUAUCUGUUC hsa-mir-199b Homo sapiens miR-199b stem-loop
hsa-miR-199b-3p ACAGUAGUCUGCACAUUGGUUA hsa-mir-199b Homo sapiens miR-199b stem-loop
hsa-miR-19a* AGUUUUGCAUAGUUGCACUACA hsa-mir-19a Homo sapiens miR-19a stem-loop
hsa-miR-19a UGUGCAAAUCUAUGCAAAACUGA hsa-mir-19a Homo sapiens miR-19a stem-loop
hsa-miR-19b-1* AGUUUUGCAGGUUUGCAUCCAGC hsa-mir-19b-1 Homo sapiens miR-19b-1 stem-loop
hsa-miR-19b UGUGCAAAUCCAUGCAAAACUGA hsa-mir-19b-1 Homo sapiens miR-19b-1 stem-loop
hsa-mir-19b-2 Homo sapiens miR-19b-2 stem-loop
hsa-miR-19b-2* AGUUUUGCAGGUUUGCAUUUCA hsa-mir-19b-2 Homo sapiens miR-19b-2 stem-loop
hsa-miR-200a* CAUCUUACCGGACAGUGCUGGA hsa-mir-200a Homo sapiens miR-200a stem-loop
hsa-miR-200a UAACACUGUCUGGUAACGAUGU hsa-mir-200a Homo sapiens miR-200a stem-loop
hsa-miR-200b* CAUCUUACUGGGCAGCAUUGGA hsa-mir-200b Homo sapiens miR-200b stem-loop
hsa-miR-200b UAAUACUGCCUGGUAAUGAUGA hsa-mir-200b Homo sapiens miR-200b stem-loop
hsa-miR-200c* CGUCUUACCCAGCAGUGUUUGG hsa-mir-200c Homo sapiens miR-200c stem-loop
hsa-miR-200c UAAUACUGCCGGGUAAUGAUGGA hsa-mir-200c Homo sapiens miR-200c stem-loop
hsa-miR-202* UUCCUAUGCAUAUACUUCUUUG hsa-mir-202 Homo sapiens miR-202 stem-loop
hsa-miR-202 AGAGGUAUAGGGCAUGGGAA hsa-mir-202 Homo sapiens miR-202 stem-loop
hsa-miR-203 GUGAAAUGUUUAGGACCACUAG hsa-mir-203 Homo sapiens miR-203 stem-loop
hsa-miR-204 UUCCCUUUGUCAUCCUAUGCCU hsa-mir-204 Homo sapiens miR-204 stem-loop
hsa-miR-205 UCCUUCAUUCCACCGGAGUCUG hsa-mir-205 Homo sapiens miR-205 stem-loop
hsa-miR-205* GAUUUCAGUGGAGUGAAGUUC hsa-mir-205 Homo sapiens miR-205 stem-loop
hsa-miR-2052 UGUUUUGAUAACAGUAAUGU hsa-mir-2052 Homo sapiens miR-2052 stem-loop
hsa-miR-2053 GUGUUAAUUAAACCUCUAUUUAC hsa-mir-2053 Homo sapiens miR-2053 stem-loop
hsa-miR-2054 CUGUAAUAUAAAUUUAAUUUAUU hsa-mir-2054 Homo sapiens miR-2054 stem-loop
hsa-miR-206 UGGAAUGUAAGGAAGUGUGUGG hsa-mir-206 Homo sapiens miR-206 stem-loop
hsa-miR-208a AUAAGACGAGCAAAAAGCUUGU hsa-mir-208a Homo sapiens miR-208a stem-loop
hsa-miR-208b AUAAGACGAACAAAAGGUUUGU hsa-mir-208b Homo sapiens miR-208b stem-loop
hsa-miR-20a UAAAGUGCUUAUAGUGCAGGUAG hsa-mir-20a Homo sapiens miR-20a stem-loop
hsa-miR-20a* ACUGCAUUAUGAGCACUUAAAG hsa-mir-20a Homo sapiens miR-20a stem-loop
hsa-miR-20b CAAAGUGCUCAUAGUGCAGGUAG hsa-mir-20b Homo sapiens miR-20b stem-loop
hsa-miR-20b* ACUGUAGUAUGGGCACUUCCAG hsa-mir-20b Homo sapiens miR-20b stem-loop
hsa-miR-21 UAGCUUAUCAGACUGAUGUUGA hsa-mir-21 Homo sapiens miR-21 stem-loop
hsa-miR-21* CAACACCAGUCGAUGGGCUGU hsa-mir-21 Homo sapiens miR-21 stem-loop
hsa-miR-210 CUGUGCGUGUGACAGCGGCUGA hsa-mir-210 Homo sapiens miR-210 stem-loop
hsa-miR-211 UUCCCUUUGUCAUCCUUCGCCU hsa-mir-211 Homo sapiens miR-211 stem-loop
hsa-miR-2110 UUGGGGAAACGGCCGCUGAGUG hsa-mir-2110 Homo sapiens miR-2110 stem-loop
hsa-miR-2113 AUUUGUGCUUGGCUCUGUCAC hsa-mir-2113 Homo sapiens mir-2113 stem-loop
hsa-miR-2114 UAGUCCCUUCCUUGAAGCGGUC hsa-mir-2114 Homo sapiens miR-2114 stem-loop
hsa-miR-2114* CGAGCCUCAAGCAAGGGACUU hsa-mir-2114 Homo sapiens miR-2114 stem-loop
hsa-miR-2115 AGCUUCCAUGACUCCUGAUGGA hsa-mir-2115 Homo sapiens miR-2115 stem-loop
hsa-miR-2115* CAUCAGAAUUCAUGGAGGCUAG hsa-mir-2115 Homo sapiens miR-2115 stem-loop
hsa-miR-2116 GGUUCUUAGCAUAGGAGGUCU hsa-mir-2116 Homo sapiens miR-2116 stem-loop
hsa-miR-2116* CCUCCCAUGCCAAGAACUCCC hsa-mir-2116 Homo sapiens miR-2116 stem-loop
hsa-miR-2117 UGUUCUCUUUGCCAAGGACAG hsa-mir-2117 Homo sapiens miR-2117 stem-loop
hsa-miR-212 UAACAGUCUCCAGUCACGGCC hsa-mir-212 Homo sapiens miR-212 stem-loop
hsa-miR-214* UGCCUGUCUACACUUGCUGUGC hsa-mir-214 Homo sapiens miR-214 stem-loop
hsa-miR-214 ACAGCAGGCACAGACAGGCAGU hsa-mir-214 Homo sapiens miR-214 stem-loop
hsa-miR-215 AUGACCUAUGAAUUGACAGAC hsa-mir-215 Homo sapiens miR-215 stem-loop
hsa-miR-216a UAAUCUCAGCUGGCAACUGUGA hsa-mir-216a Homo sapiens miR-216a stem-loop
hsa-miR-216b AAAUCUCUGCAGGCAAAUGUGA hsa-mir-216b Homo sapiens miR-216b stem-loop
hsa-miR-217 UACUGCAUCAGGAACUGAUUGGA hsa-mir-217 Homo sapiens miR-217 stem-loop
hsa-miR-218 UUGUGCUUGAUCUAACCAUGU hsa-mir-218-1 Homo sapiens miR-218-1 stem-loop
hsa-mir-218-2 Homo sapiens miR-218-2 stem-loop
hsa-miR-218-1* AUGGUUCCGUCAAGCACCAUGG hsa-mir-218-1 Homo sapiens miR-218-1 stem-loop
hsa-miR-218-2* CAUGGUUCUGUCAAGCACCGCG hsa-mir-218-2 Homo sapiens miR-218-2 stem-loop
hsa-miR-219-5p UGAUUGUCCAAACGCAAUUCU hsa-mir-219-1 Homo sapiens miR-219-1 stem-loop
hsa-mir-219-2 Homo sapiens miR-219-2 stem-loop
hsa-miR-219-1-3p AGAGUUGAGUCUGGACGUCCCG hsa-mir-219-1 Homo sapiens miR-219-1 stem-loop
hsa-miR-219-2-3p AGAAUUGUGGCUGGACAUCUGU hsa-mir-219-2 Homo sapiens miR-219-2 stem-loop
hsa-miR-22* AGUUCUUCAGUGGCAAGCUUUA hsa-mir-22 Homo sapiens miR-22 stem-loop
hsa-miR-22 AAGCUGCCAGUUGAAGAACUGU hsa-mir-22 Homo sapiens miR-22 stem-loop
hsa-miR-221* ACCUGGCAUACAAUGUAGAUUU hsa-mir-221 Homo sapiens miR-221 stem-loop
hsa-miR-221 AGCUACAUUGUCUGCUGGGUUUC hsa-mir-221 Homo sapiens miR-221 stem-loop
hsa-miR-222* CUCAGUAGCCAGUGUAGAUCCU hsa-mir-222 Homo sapiens miR-222 stem-loop
hsa-miR-222 AGCUACAUCUGGCUACUGGGU hsa-mir-222 Homo sapiens miR-222 stem-loop
hsa-miR-223* CGUGUAUUUGACAAGCUGAGUU hsa-mir-223 Homo sapiens miR-223 stem-loop
hsa-miR-223 UGUCAGUUUGUCAAAUACCCCA hsa-mir-223 Homo sapiens miR-223 stem-loop
hsa-miR-224 CAAGUCACUAGUGGUUCCGUU hsa-mir-224 Homo sapiens miR-224 stem-loop
hsa-miR-224* AAAAUGGUGCCCUAGUGACUACA hsa-mir-224 Homo sapiens miR-224 stem-loop
hsa-miR-2276 UCUGCAAGUGUCAGAGGCGAGG hsa-mir-2276 Homo sapiens miR-2276 stem-loop
hsa-miR-2277-5p AGCGCGGGCUGAGCGCUGCCAGUC hsa-mir-2277 Homo sapiens miR-2277 stem-loop
hsa-miR-2277-3p UGACAGCGCCCUGCCUGGCUC hsa-mir-2277 Homo sapiens miR-2277 stem-loop
hsa-miR-2278 GAGAGCAGUGUGUGUUGCCUGG hsa-mir-2278 Homo sapiens miR-2278 stem-loop
hsa-miR-2355-5p AUCCCCAGAUACAAUGGACAA hsa-mir-2355 Homo sapiens miR-2355 stem-loop
hsa-miR-2355-3p AUUGUCCUUGCUGUUUGGAGAU hsa-mir-2355 Homo sapiens miR-2355 stem-loop
hsa-miR-23a* GGGGUUCCUGGGGAUGGGAUUU hsa-mir-23a Homo sapiens miR-23a stem-loop
hsa-miR-23a AUCACAUUGCCAGGGAUUUCC hsa-mir-23a Homo sapiens miR-23a stem-loop
hsa-miR-23b* UGGGUUCCUGGCAUGCUGAUUU hsa-mir-23b Homo sapiens miR-23b stem-loop
hsa-miR-23b AUCACAUUGCCAGGGAUUACC hsa-mir-23b Homo sapiens miR-23b stem-loop
hsa-miR-23c AUCACAUUGCCAGUGAUUACCC hsa-mir-23c Homo sapiens miR-23c stem-loop
hsa-miR-24-1* UGCCUACUGAGCUGAUAUCAGU hsa-mir-24-1 Homo sapiens miR-24-1 stem-loop
hsa-miR-24 UGGCUCAGUUCAGCAGGAACAG hsa-mir-24-1 Homo sapiens miR-24-1 stem-loop
hsa-mir-24-2 Homo sapiens miR-24-2 stem-loop
hsa-miR-24-2* UGCCUACUGAGCUGAAACACAG hsa-mir-24-2 Homo sapiens miR-24-2 stem-loop
hsa-miR-25* AGGCGGAGACUUGGGCAAUUG hsa-mir-25 Homo sapiens miR-25 stem-loop
hsa-miR-25 CAUUGCACUUGUCUCGGUCUGA hsa-mir-25 Homo sapiens miR-25 stem-loop
hsa-miR-26a UUCAAGUAAUCCAGGAUAGGCU hsa-mir-26a-1 Homo sapiens miR-26a-1 stem-loop
hsa-mir-26a-2 Homo sapiens miR-26a-2 stem-loop
hsa-miR-26a-1* CCUAUUCUUGGUUACUUGCACG hsa-mir-26a-1 Homo sapiens miR-26a-1 stem-loop
hsa-miR-26a-2* CCUAUUCUUGAUUACUUGUUUC hsa-mir-26a-2 Homo sapiens miR-26a-2 stem-loop
hsa-miR-26b UUCAAGUAAUUCAGGAUAGGU hsa-mir-26b Homo sapiens miR-26b stem-loop
hsa-miR-26b* CCUGUUCUCCAUUACUUGGCUC hsa-mir-26b Homo sapiens miR-26b stem-loop
hsa-miR-27a* AGGGCUUAGCUGCUUGUGAGCA hsa-mir-27a Homo sapiens miR-27a stem-loop
hsa-miR-27a UUCACAGUGGCUAAGUUCCGC hsa-mir-27a Homo sapiens miR-27a stem-loop
hsa-miR-27b* AGAGCUUAGCUGAUUGGUGAAC hsa-mir-27b Homo sapiens miR-27b stem-loop
hsa-miR-27b UUCACAGUGGCUAAGUUCUGC hsa-mir-27b Homo sapiens miR-27b stem-loop
hsa-miR-28-5p AAGGAGCUCACAGUCUAUUGAG hsa-mir-28 Homo sapiens miR-28 stem-loop
hsa-miR-28-3p CACUAGAUUGUGAGCUCCUGGA hsa-mir-28 Homo sapiens miR-28 stem-loop
hsa-miR-2861 GGGGCCUGGCGGUGGGCGG hsa-mir-2861 Homo sapiens miR-2861 stem-loop
hsa-miR-2909 GUUAGGGCCAACAUCUCUUGG hsa-mir-2909 Homo sapiens miR-2909 stem-loop
hsa-miR-296-5p AGGGCCCCCCCUCAAUCCUGU hsa-mir-296 Homo sapiens miR-296 stem-loop
hsa-miR-296-3p GAGGGUUGGGUGGAGGCUCUCC hsa-mir-296 Homo sapiens miR-296 stem-loop
hsa-miR-297 AUGUAUGUGUGCAUGUGCAUG hsa-mir-297 Homo sapiens miR-297 stem-loop
hsa-miR-298 AGCAGAAGCAGGGAGGUUCUCCCA hsa-mir-298 Homo sapiens miR-298 stem-loop
hsa-miR-299-5p UGGUUUACCGUCCCACAUACAU hsa-mir-299 Homo sapiens miR-299 stem-loop
hsa-miR-299-3p UAUGUGGGAUGGUAAACCGCUU hsa-mir-299 Homo sapiens miR-299 stem-loop
hsa-miR-29a* ACUGAUUUCUUUUGGUGUUCAG hsa-mir-29a Homo sapiens miR-29a stem-loop
hsa-miR-29a UAGCACCAUCUGAAAUCGGUUA hsa-mir-29a Homo sapiens miR-29a stem-loop
hsa-miR-29b-1* GCUGGUUUCAUAUGGUGGUUUAGA hsa-mir-29b-1 Homo sapiens miR-29b-1 stem-loop
hsa-miR-29b UAGCACCAUUUGAAAUCAGUGUU hsa-mir-29b-1 Homo sapiens miR-29b-1 stem-loop
hsa-mir-29b-2 Homo sapiens miR-29b-2 stem-loop
hsa-miR-29b-2* CUGGUUUCACAUGGUGGCUUAG hsa-mir-29b-2 Homo sapiens miR-29b-2 stem-loop
hsa-miR-29c* UGACCGAUUUCUCCUGGUGUUC hsa-mir-29c Homo sapiens miR-29c stem-loop
hsa-miR-29c UAGCACCAUUUGAAAUCGGUUA hsa-mir-29c Homo sapiens miR-29c stem-loop
hsa-miR-300 UAUACAAGGGCAGACUCUCUCU hsa-mir-300 Homo sapiens miR-300 stem-loop
hsa-miR-301a CAGUGCAAUAGUAUUGUCAAAGC hsa-mir-301a Homo sapiens miR-301a stem-loop
hsa-miR-301b CAGUGCAAUGAUAUUGUCAAAGC hsa-mir-301b Homo sapiens miR-301b stem-loop
hsa-miR-302a* ACUUAAACGUGGAUGUACUUGCU hsa-mir-302a Homo sapiens miR-302a stem-loop
hsa-miR-302a UAAGUGCUUCCAUGUUUUGGUGA hsa-mir-302a Homo sapiens miR-302a stem-loop
hsa-miR-302b* ACUUUAACAUGGAAGUGCUUUC hsa-mir-302b Homo sapiens miR-302b stem-loop
hsa-miR-302b UAAGUGCUUCCAUGUUUUAGUAG hsa-mir-302b Homo sapiens miR-302b stem-loop
hsa-miR-302c* UUUAACAUGGGGGUACCUGCUG hsa-mir-302c Homo sapiens miR-302c stem-loop
hsa-miR-302c UAAGUGCUUCCAUGUUUCAGUGG hsa-mir-302c Homo sapiens miR-302c stem-loop
hsa-miR-302d* ACUUUAACAUGGAGGCACUUGC hsa-mir-302d Homo sapiens miR-302d stem-loop
hsa-miR-302d UAAGUGCUUCCAUGUUUGAGUGU hsa-mir-302d Homo sapiens miR-302d stem-loop
hsa-miR-302e UAAGUGCUUCCAUGCUU hsa-mir-302e Homo sapiens miR-302e stem-loop
hsa-miR-302f UAAUUGCUUCCAUGUUU hsa-mir-302f Homo sapiens miR-302f stem-loop
hsa-miR-3065-5p UCAACAAAAUCACUGAUGCUGGA hsa-mir-3065 Homo sapiens miR-3065 stem-loop
hsa-miR-3065-3p UCAGCACCAGGAUAUUGUUGGAG hsa-mir-3065 Homo sapiens miR-3065 stem-loop
hsa-miR-3074 GAUAUCAGCUCAGUAGGCACCG hsa-mir-3074 Homo sapiens miR-3074 stem-loop
hsa-miR-30a UGUAAACAUCCUCGACUGGAAG hsa-mir-30a Homo sapiens miR-30a stem-loop
hsa-miR-30a* CUUUCAGUCGGAUGUUUGCAGC hsa-mir-30a Homo sapiens miR-30a stem-loop
hsa-miR-30b UGUAAACAUCCUACACUCAGCU hsa-mir-30b Homo sapiens miR-30b stem-loop
hsa-miR-30b* CUGGGAGGUGGAUGUUUACUUC hsa-mir-30b Homo sapiens miR-30b stem-loop
hsa-miR-30c UGUAAACAUCCUACACUCUCAGC hsa-mir-30c-1 Homo sapiens miR-30c-1 stem-loop
hsa-mir-30c-2 Homo sapiens miR-30c-2 stem-loop
hsa-miR-30c-1* CUGGGAGAGGGUUGUUUACUCC hsa-mir-30c-1 Homo sapiens miR-30c-1 stem-loop
hsa-miR-30c-2* CUGGGAGAAGGCUGUUUACUCU hsa-mir-30c-2 Homo sapiens miR-30c-2 stem-loop
hsa-miR-30d UGUAAACAUCCCCGACUGGAAG hsa-mir-30d Homo sapiens miR-30d stem-loop
hsa-miR-30d* CUUUCAGUCAGAUGUUUGCUGC hsa-mir-30d Homo sapiens miR-30d stem-loop
hsa-miR-30e UGUAAACAUCCUUGACUGGAAG hsa-mir-30e Homo sapiens miR-30e stem-loop
hsa-miR-30e* CUUUCAGUCGGAUGUUUACAGC hsa-mir-30e Homo sapiens miR-30e stem-loop
hsa-miR-31 AGGCAAGAUGCUGGCAUAGCU hsa-mir-31 Homo sapiens miR-31 stem-loop
hsa-miR-31* UGCUAUGCCAACAUAUUGCCAU hsa-mir-31 Homo sapiens miR-31 stem-loop
hsa-miR-3115 AUAUGGGUUUACUAGUUGGU hsa-mir-3115 Homo sapiens miR-3115 stem-loop
hsa-miR-3116 UGCCUGGAACAUAGUAGGGACU hsa-mir-3116-1 Homo sapiens miR-3116-1 stem-loop
hsa-mir-3116-2 Homo sapiens miR-3116-2 stem-loop
hsa-miR-3117 AUAGGACUCAUAUAGUGCCAG hsa-mir-3117 Homo sapiens miR-3117 stem-loop
hsa-miR-3118 UGUGACUGCAUUAUGAAAAUUCU hsa-mir-3118-1 Homo sapiens miR-3118-1 stem-loop
hsa-mir-3118-2 Homo sapiens miR-3118-2 stem-loop
hsa-mir-3118-3 Homo sapiens miR-3118-3 stem-loop
hsa-mir-3118-4 Homo sapiens miR-3118-4 stem-loop
hsa-mir-3118-5 Homo sapiens miR-3118-5 stem-loop
hsa-mir-3118-6 Homo sapiens miR-3118-6 stem-loop
hsa-miR-3119 UGGCUUUUAACUUUGAUGGC hsa-mir-3119-1 Homo sapiens miR-3119-1 stem-loop
hsa-mir-3119-2 Homo sapiens miR-3119-2 stem-loop
hsa-miR-3120 CACAGCAAGUGUAGACAGGCA hsa-mir-3120 Homo sapiens miR-3120 stem-loop
hsa-miR-3121 UAAAUAGAGUAGGCAAAGGACA hsa-mir-3121 Homo sapiens miR-3121 stem-loop
hsa-miR-3122 GUUGGGACAAGAGGACGGUCUU hsa-mir-3122 Homo sapiens miR-3122 stem-loop
hsa-miR-3123 CAGAGAAUUGUUUAAUC hsa-mir-3123 Homo sapiens miR-3123 stem-loop
hsa-miR-3124 UUCGCGGGCGAAGGCAAAGUC hsa-mir-3124 Homo sapiens miR-3124 stem-loop
hsa-miR-3125 UAGAGGAAGCUGUGGAGAGA hsa-mir-3125 Homo sapiens miR-3125 stem-loop
hsa-miR-3126-5p UGAGGGACAGAUGCCAGAAGCA hsa-mir-3126 Homo sapiens miR-3126 stem-loop
hsa-miR-3126-3p CAUCUGGCAUCCGUCACACAGA hsa-mir-3126 Homo sapiens miR-3126 stem-loop
hsa-miR-3127 AUCAGGGCUUGUGGAAUGGGAAG hsa-mir-3127 Homo sapiens miR-3127 stem-loop
hsa-miR-3128 UCUGGCAAGUAAAAAACUCUCAU hsa-mir-3128 Homo sapiens miR-3128 stem-loop
hsa-miR-3129 GCAGUAGUGUAGAGAUUGGUUU hsa-mir-3129 Homo sapiens miR-3129 stem-loop
hsa-miR-3130-5p UACCCAGUCUCCGGUGCAGCC hsa-mir-3130-1 Homo sapiens miR-3130-1 stem-loop
hsa-mir-3130-2 Homo sapiens miR-3130-2 stem-loop
hsa-miR-3130-3p GCUGCACCGGAGACUGGGUAA hsa-mir-3130-1 Homo sapiens miR-3130-1 stem-loop
hsa-mir-3130-2 Homo sapiens miR-3130-2 stem-loop
hsa-miR-3131 UCGAGGACUGGUGGAAGGGCCUU hsa-mir-3131 Homo sapiens miR-3131 stem-loop
hsa-miR-3132 UGGGUAGAGAAGGAGCUCAGAGGA hsa-mir-3132 Homo sapiens miR-3132 stem-loop
hsa-miR-3133 UAAAGAACUCUUAAAACCCAAU hsa-mir-3133 Homo sapiens miR-3133 stem-loop
hsa-miR-3134 UGAUGGAUAAAAGACUACAUAUU hsa-mir-3134 Homo sapiens miR-3134 stem-loop
hsa-miR-3135 UGCCUAGGCUGAGACUGCAGUG hsa-mir-3135 Homo sapiens miR-3135 stem-loop
hsa-miR-3136 CUGACUGAAUAGGUAGGGUCAUU hsa-mir-3136 Homo sapiens miR-3136 stem-loop
hsa-miR-3137 UCUGUAGCCUGGGAGCAAUGGGGU hsa-mir-3137 Homo sapiens miR-3137 stem-loop
hsa-miR-3138 UGUGGACAGUGAGGUAGAGGGAGU hsa-mir-3138 Homo sapiens miR-3138 stem-loop
hsa-miR-3139 UAGGAGCUCAACAGAUGCCUGUU hsa-mir-3139 Homo sapiens miR-3139 stem-loop
hsa-miR-3140 AGCUUUUGGGAAUUCAGGUAGU hsa-mir-3140 Homo sapiens miR-3140 stem-loop
hsa-miR-3141 GAGGGCGGGUGGAGGAGGA hsa-mir-3141 Homo sapiens miR-3141 stem-loop
hsa-miR-3142 AAGGCCUUUCUGAACCUUCAGA hsa-mir-3142 Homo sapiens miR-3142 stem-loop
hsa-miR-3143 AUAACAUUGUAAAGCGCUUCUUUCG hsa-mir-3143 Homo sapiens miR-3143 stem-loop
hsa-miR-3144-5p AGGGGACCAAAGAGAUAUAUAG hsa-mir-3144 Homo sapiens miR-3144 stem-loop
hsa-miR-3144-3p AUAUACCUGUUCGGUCUCUUUA hsa-mir-3144 Homo sapiens miR-3144 stem-loop
hsa-miR-3145 AGAUAUUUUGAGUGUUUGGAAUUG hsa-mir-3145 Homo sapiens miR-3145 stem-loop
hsa-miR-3146 CAUGCUAGGAUAGAAAGAAUGG hsa-mir-3146 Homo sapiens miR-3146 stem-loop
hsa-miR-3147 GGUUGGGCAGUGAGGAGGGUGUGA hsa-mir-3147 Homo sapiens miR-3147 stem-loop
hsa-miR-3148 UGGAAAAAACUGGUGUGUGCUU hsa-mir-3148 Homo sapiens miR-3148 stem-loop
hsa-miR-3149 UUUGUAUGGAUAUGUGUGUGUAU hsa-mir-3149 Homo sapiens miR-3149 stem-loop
hsa-miR-3150 CUGGGGAGAUCCUCGAGGUUGG hsa-mir-3150 Homo sapiens miR-3150 stem-loop
hsa-miR-3150b UGAGGAGAUCGUCGAGGUUGG hsa-mir-3150b Homo sapiens miR-3150b stem-loop
hsa-miR-3151 GGUGGGGCAAUGGGAUCAGGU hsa-mir-3151 Homo sapiens miR-3151 stem-loop
hsa-miR-3152 UGUGUUAGAAUAGGGGCAAUAA hsa-mir-3152 Homo sapiens miR-3152 stem-loop
hsa-miR-3153 GGGGAAAGCGAGUAGGGACAUUU hsa-mir-3153 Homo sapiens miR-3153 stem-loop
hsa-miR-3154 CAGAAGGGGAGUUGGGAGCAGA hsa-mir-3154 Homo sapiens miR-3154 stem-loop
hsa-miR-3155 CCAGGCUCUGCAGUGGGAACU hsa-mir-3155 Homo sapiens miR-3155 stem-loop
hsa-miR-3156 AAAGAUCUGGAAGUGGGAGACA hsa-mir-3156-1 Homo sapiens miR-3156-1 stem-loop
hsa-mir-3156-2 Homo sapiens miR-3156-2 stem-loop
hsa-mir-3156-3 Homo sapiens miR-3156-3 stem-loop
hsa-miR-3157 UUCAGCCAGGCUAGUGCAGUCU hsa-mir-3157 Homo sapiens miR-3157 stem-loop
hsa-miR-3158 AAGGGCUUCCUCUCUGCAGGAC hsa-mir-3158-1 Homo sapiens miR-3158-1 stem-loop
hsa-mir-3158-2 Homo sapiens miR-3158-2 stem-loop
hsa-miR-3159 UAGGAUUACAAGUGUCGGCCAC hsa-mir-3159 Homo sapiens miR-3159 stem-loop
hsa-miR-3160 AGAGCUGAGACUAGAAAGCCCA hsa-mir-3160-1 Homo sapiens miR-3160-1 stem-loop
hsa-mir-3160-2 Homo sapiens miR-3160-2 stem-loop
hsa-miR-3161 CUGAUAAGAACAGAGGCCCAGAU hsa-mir-3161 Homo sapiens miR-3161 stem-loop
hsa-miR-3162 UUAGGGAGUAGAAGGGUGGGGAG hsa-mir-3162 Homo sapiens miR-3162 stem-loop
hsa-miR-3163 UAUAAAAUGAGGGCAGUAAGAC hsa-mir-3163 Homo sapiens miR-3163 stem-loop
hsa-miR-3164 UGUGACUUUAAGGGAAAUGGCG hsa-mir-3164 Homo sapiens miR-3164 stem-loop
hsa-miR-3165 AGGUGGAUGCAAUGUGACCUCA hsa-mir-3165 Homo sapiens miR-3165 stem-loop
hsa-miR-3166 CGCAGACAAUGCCUACUGGCCUA hsa-mir-3166 Homo sapiens miR-3166 stem-loop
hsa-miR-3167 AGGAUUUCAGAAAUACUGGUGU hsa-mir-3167 Homo sapiens miR-3167 stem-loop
hsa-miR-3168 GAGUUCUACAGUCAGAC hsa-mir-3168 Homo sapiens miR-3168 stem-loop
hsa-miR-3169 UAGGACUGUGCUUGGCACAUAG hsa-mir-3169 Homo sapiens miR-3169 stem-loop
hsa-miR-3170 CUGGGGUUCUGAGACAGACAGU hsa-mir-3170 Homo sapiens miR-3170 stem-loop
hsa-miR-3171 AGAUGUAUGGAAUCUGUAUAUAUC hsa-mir-3171 Homo sapiens miR-3171 stem-loop
hsa-miR-3173 AAAGGAGGAAAUAGGCAGGCCA hsa-mir-3173 Homo sapiens miR-3173 stem-loop
hsa-miR-3174 UAGUGAGUUAGAGAUGCAGAGCC hsa-mir-3174 Homo sapiens miR-3174 stem-loop
hsa-miR-3175 CGGGGAGAGAACGCAGUGACGU hsa-mir-3175 Homo sapiens miR-3175 stem-loop
hsa-miR-3176 ACUGGCCUGGGACUACCGG hsa-mir-3176 Homo sapiens miR-3176 stem-loop
hsa-miR-3177 UGCACGGCACUGGGGACACGU hsa-mir-3177 Homo sapiens miR-3177 stem-loop
hsa-miR-3178 GGGGCGCGGCCGGAUCG hsa-mir-3178 Homo sapiens miR-3178 stem-loop
hsa-miR-3179 AGAAGGGGUGAAAUUUAAACGU hsa-mir-3179-1 Homo sapiens miR-3179-1 stem-loop
hsa-mir-3179-2 Homo sapiens miR-3179-2 stem-loop
hsa-mir-3179-3 Homo sapiens miR-3179-3 stem-loop
hsa-miR-3180-5p CUUCCAGACGCUCCGCCCCACGUCG hsa-mir-3180-1 Homo sapiens miR-3180-1 stem-loop
hsa-mir-3180-2 Homo sapiens miR-3180-2 stem-loop
hsa-mir-3180-3 Homo sapiens miR-3180-3 stem-loop
hsa-miR-3180-3p UGGGGCGGAGCUUCCGGAGGCC hsa-mir-3180-1 Homo sapiens miR-3180-1 stem-loop
hsa-mir-3180-2 Homo sapiens miR-3180-2 stem-loop
hsa-mir-3180-3 Homo sapiens miR-3180-3 stem-loop
hsa-miR-3180 UGGGGCGGAGCUUCCGGAG hsa-mir-3180-4 Homo sapiens miR-3180-4 stem-loop
hsa-mir-3180-5 Homo sapiens miR-3180-5 stem-loop
hsa-miR-3181 AUCGGGCCCUCGGCGCCGG hsa-mir-3181 Homo sapiens miR-3181 stem-loop
hsa-miR-3182 GCUUCUGUAGUGUAGUC hsa-mir-3182 Homo sapiens miR-3182 stem-loop
hsa-miR-3183 GCCUCUCUCGGAGUCGCUCGGA hsa-mir-3183 Homo sapiens miR-3183 stem-loop
hsa-miR-3184 UGAGGGGCCUCAGACCGAGCUUUU hsa-mir-3184 Homo sapiens miR-3184 stem-loop
hsa-miR-3185 AGAAGAAGGCGGUCGGUCUGCGG hsa-mir-3185 Homo sapiens miR-3185 stem-loop
hsa-miR-3186-5p CAGGCGUCUGUCUACGUGGCUU hsa-mir-3186 Homo sapiens miR-3186 stem-loop
hsa-miR-3186-3p UCACGCGGAGAGAUGGCUUUG hsa-mir-3186 Homo sapiens miR-3186 stem-loop
hsa-miR-3187 UUGGCCAUGGGGCUGCGCGG hsa-mir-3187 Homo sapiens miR-3187 stem-loop
hsa-miR-3188 AGAGGCUUUGUGCGGAUACGGGG hsa-mir-3188 Homo sapiens miR-3188 stem-loop
hsa-miR-3189 CCCUUGGGUCUGAUGGGGUAG hsa-mir-3189 Homo sapiens miR-3189 stem-loop
hsa-miR-3190 UGUGGAAGGUAGACGGCCAGAGA hsa-mir-3190 Homo sapiens miR-3190 stem-loop
hsa-miR-3191 UGGGGACGUAGCUGGCCAGACAG hsa-mir-3191 Homo sapiens miR-3191 stem-loop
hsa-miR-3192 UCUGGGAGGUUGUAGCAGUGGAA hsa-mir-3192 Homo sapiens miR-3192 stem-loop
hsa-miR-3193 UCCUGCGUAGGAUCUGAGGAGU hsa-mir-3193 Homo sapiens miR-3193 stem-loop
hsa-miR-3194 GGCCAGCCACCAGGAGGGCUG hsa-mir-3194 Homo sapiens miR-3194 stem-loop
hsa-miR-3195 CGCGCCGGGCCCGGGUU hsa-mir-3195 Homo sapiens miR-3195 stem-loop
hsa-miR-3196 CGGGGCGGCAGGGGCCUC hsa-mir-3196 Homo sapiens miR-3196 stem-loop
hsa-miR-3197 GGAGGCGCAGGCUCGGAAAGGCG hsa-mir-3197 Homo sapiens miR-3197 stem-loop
hsa-miR-3198 GUGGAGUCCUGGGGAAUGGAGA hsa-mir-3198 Homo sapiens miR-3198 stem-loop
hsa-miR-3199 AGGGACUGCCUUAGGAGAAAGUU hsa-mir-3199-1 Homo sapiens miR-3199-1 stem-loop
hsa-mir-3199-2 Homo sapiens miR-3199-2 stem-loop
hsa-miR-32 UAUUGCACAUUACUAAGUUGCA hsa-mir-32 Homo sapiens miR-32 stem-loop
hsa-miR-32* CAAUUUAGUGUGUGUGAUAUUU hsa-mir-32 Homo sapiens miR-32 stem-loop
hsa-miR-3200-5p AAUCUGAGAAGGCGCACAAGGU hsa-mir-3200 Homo sapiens miR-3200 stem-loop
hsa-miR-3200-3p CACCUUGCGCUACUCAGGUCUG hsa-mir-3200 Homo sapiens miR-3200 stem-loop
hsa-miR-3201 GGGAUAUGAAGAAAAAU hsa-mir-3201 Homo sapiens miR-3201 stem-loop
hsa-miR-3202 UGGAAGGGAGAAGAGCUUUAAU hsa-mir-3202-1 Homo sapiens miR-3202-1 stem-loop
hsa-mir-3202-2 Homo sapiens miR-3202-2 stem-loop
hsa-miR-320a AAAAGCUGGGUUGAGAGGGCGA hsa-mir-320a Homo sapiens miR-320a stem-loop
hsa-miR-320b AAAAGCUGGGUUGAGAGGGCAA hsa-mir-320b-1 Homo sapiens mir-320b-1 stem-loop
hsa-mir-320b-2 Homo sapiens miR-320b-2 stem-loop
hsa-miR-320c AAAAGCUGGGUUGAGAGGGU hsa-mir-320c-1 Homo sapiens mir-320c-1 stem-loop
hsa-mir-320c-2 Homo sapiens miR-320c-2 stem-loop
hsa-miR-320d AAAAGCUGGGUUGAGAGGA hsa-mir-320d-1 Homo sapiens miR-320d-1 stem-loop
hsa-mir-320d-2 Homo sapiens miR-320d-2 stem-loop
hsa-miR-320e AAAGCUGGGUUGAGAAGG hsa-mir-320e Homo sapiens miR-320e stem-loop
hsa-miR-323-5p AGGUGGUCCGUGGCGCGUUCGC hsa-mir-323 Homo sapiens miR-323 stem-loop
hsa-miR-323-3p CACAUUACACGGUCGACCUCU hsa-mir-323 Homo sapiens miR-323 stem-loop
hsa-miR-323b-5p AGGUUGUCCGUGGUGAGUUCGCA hsa-mir-323b Homo sapiens miR-323b stem-loop
hsa-miR-323b-3p CCCAAUACACGGUCGACCUCUU hsa-mir-323b Homo sapiens miR-323b stem-loop
hsa-miR-324-5p CGCAUCCCCUAGGGCAUUGGUGU hsa-mir-324 Homo sapiens miR-324 stem-loop
hsa-miR-324-3p ACUGCCCCAGGUGCUGCUGG hsa-mir-324 Homo sapiens miR-324 stem-loop
hsa-miR-325 CCUAGUAGGUGUCCAGUAAGUGU hsa-mir-325 Homo sapiens miR-325 stem-loop
hsa-miR-326 CCUCUGGGCCCUUCCUCCAG hsa-mir-326 Homo sapiens miR-326 stem-loop
hsa-miR-328 CUGGCCCUCUCUGCCCUUCCGU hsa-mir-328 Homo sapiens miR-328 stem-loop
hsa-miR-329 AACACACCUGGUUAACCUCUUU hsa-mir-329-1 Homo sapiens miR-329-1 stem-loop
hsa-mir-329-2 Homo sapiens miR-329-2 stem-loop
hsa-miR-330-5p UCUCUGGGCCUGUGUCUUAGGC hsa-mir-330 Homo sapiens miR-330 stem-loop
hsa-miR-330-3p GCAAAGCACACGGCCUGCAGAGA hsa-mir-330 Homo sapiens miR-330 stem-loop
hsa-miR-331-5p CUAGGUAUGGUCCCAGGGAUCC hsa-mir-331 Homo sapiens miR-331 stem-loop
hsa-miR-331-3p GCCCCUGGGCCUAUCCUAGAA hsa-mir-331 Homo sapiens miR-331 stem-loop
hsa-miR-335 UCAAGAGCAAUAACGAAAAAUGU hsa-mir-335 Homo sapiens miR-335 stem-loop
hsa-miR-335* UUUUUCAUUAUUGCUCCUGACC hsa-mir-335 Homo sapiens miR-335 stem-loop
hsa-miR-337-5p GAACGGCUUCAUACAGGAGUU hsa-mir-337 Homo sapiens miR-337 stem-loop
hsa-miR-337-3p CUCCUAUAUGAUGCCUUUCUUC hsa-mir-337 Homo sapiens miR-337 stem-loop
hsa-miR-338-5p AACAAUAUCCUGGUGCUGAGUG hsa-mir-338 Homo sapiens miR-338 stem-loop
hsa-miR-338-3p UCCAGCAUCAGUGAUUUUGUUG hsa-mir-338 Homo sapiens miR-338 stem-loop
hsa-miR-339-5p UCCCUGUCCUCCAGGAGCUCACG hsa-mir-339 Homo sapiens miR-339 stem-loop
hsa-miR-339-3p UGAGCGCCUCGACGACAGAGCCG hsa-mir-339 Homo sapiens miR-339 stem-loop
hsa-miR-33a GUGCAUUGUAGUUGCAUUGCA hsa-mir-33a Homo sapiens miR-33a stem-loop
hsa-miR-33a* CAAUGUUUCCACAGUGCAUCAC hsa-mir-33a Homo sapiens miR-33a stem-loop
hsa-miR-33b GUGCAUUGCUGUUGCAUUGC hsa-mir-33b Homo sapiens miR-33b stem-loop
hsa-miR-33b* CAGUGCCUCGGCAGUGCAGCCC hsa-mir-33b Homo sapiens miR-33b stem-loop
hsa-miR-340 UUAUAAAGCAAUGAGACUGAUU hsa-mir-340 Homo sapiens miR-340 stem-loop
hsa-miR-340* UCCGUCUCAGUUACUUUAUAGC hsa-mir-340 Homo sapiens miR-340 stem-loop
hsa-miR-342-5p AGGGGUGCUAUCUGUGAUUGA hsa-mir-342 Homo sapiens miR-342 stem-loop
hsa-miR-342-3p UCUCACACAGAAAUCGCACCCGU hsa-mir-342 Homo sapiens miR-342 stem-loop
hsa-miR-345 GCUGACUCCUAGUCCAGGGCUC hsa-mir-345 Homo sapiens miR-345 stem-loop
hsa-miR-346 UGUCUGCCCGCAUGCCUGCCUCU hsa-mir-346 Homo sapiens miR-346 stem-loop
hsa-miR-34a UGGCAGUGUCUUAGCUGGUUGU hsa-mir-34a Homo sapiens miR-34a stem-loop
hsa-miR-34a* CAAUCAGCAAGUAUACUGCCCU hsa-mir-34a Homo sapiens miR-34a stem-loop
hsa-miR-34b* UAGGCAGUGUCAUUAGCUGAUUG hsa-mir-34b Homo sapiens miR-34b stem-loop
hsa-miR-34b CAAUCACUAACUCCACUGCCAU hsa-mir-34b Homo sapiens miR-34b stem-loop
hsa-miR-34c-5p AGGCAGUGUAGUUAGCUGAUUGC hsa-mir-34c Homo sapiens miR-34c stem-loop
hsa-miR-34c-3p AAUCACUAACCACACGGCCAGG hsa-mir-34c Homo sapiens miR-34c stem-loop
hsa-miR-3605-5p UGAGGAUGGAUAGCAAGGAAGCC hsa-mir-3605 Homo sapiens miR-3605 stem-loop
hsa-miR-3605-3p CCUCCGUGUUACCUGUCCUCUAG hsa-mir-3605 Homo sapiens miR-3605 stem-loop
hsa-miR-3606 UUAGUGAAGGCUAUUUUAAUU hsa-mir-3606 Homo sapiens miR-3606 stem-loop
hsa-miR-3607-5p GCAUGUGAUGAAGCAAAUCAGU hsa-mir-3607 Homo sapiens miR-3607 stem-loop
hsa-miR-3607-3p ACUGUAAACGCUUUCUGAUG hsa-mir-3607 Homo sapiens miR-3607 stem-loop
hsa-miR-3609 CAAAGUGAUGAGUAAUACUGGCUG hsa-mir-3609 Homo sapiens miR-3609 stem-loop
hsa-miR-361-5p UUAUCAGAAUCUCCAGGGGUAC hsa-mir-361 Homo sapiens miR-361 stem-loop
hsa-miR-361-3p UCCCCCAGGUGUGAUUCUGAUUU hsa-mir-361 Homo sapiens miR-361 stem-loop
hsa-miR-3610 GAAUCGGAAAGGAGGCGCCG hsa-mir-3610 Homo sapiens miR-3610 stem-loop
hsa-miR-3611 UUGUGAAGAAAGAAAUUCUUA hsa-mir-3611 Homo sapiens miR-3611 stem-loop
hsa-miR-3612 AGGAGGCAUCUUGAGAAAUGGA hsa-mir-3612 Homo sapiens miR-3612 stem-loop
hsa-miR-3613-5p UGUUGUACUUUUUUUUUUGUUC hsa-mir-3613 Homo sapiens miR-3613 stem-loop
hsa-miR-3613-3p ACAAAAAAAAAAGCCCAACCCUUC hsa-mir-3613 Homo sapiens miR-3613 stem-loop
hsa-miR-3614-5p CCACUUGGAUCUGAAGGCUGCCC hsa-mir-3614 Homo sapiens miR-3614 stem-loop
hsa-miR-3614-3p UAGCCUUCAGAUCUUGGUGUUUU hsa-mir-3614 Homo sapiens miR-3614 stem-loop
hsa-miR-3615 UCUCUCGGCUCCUCGCGGCUC hsa-mir-3615 Homo sapiens miR-3615 stem-loop
hsa-miR-3616-5p AUGAAGUGCACUCAUGAUAUGU hsa-mir-3616 Homo sapiens miR-3616 stem-loop
hsa-miR-3616-3p CGAGGGCAUUUCAUGAUGCAGGC hsa-mir-3616 Homo sapiens miR-3616 stem-loop
hsa-miR-3617 AAAGACAUAGUUGCAAGAUGGG hsa-mir-3617 Homo sapiens miR-3617 stem-loop
hsa-miR-3618 UGUCUACAUUAAUGAAAAGAGC hsa-mir-3618 Homo sapiens miR-3618 stem-loop
hsa-miR-3619 UCAGCAGGCAGGCUGGUGCAGC hsa-mir-3619 Homo sapiens miR-3619 stem-loop
hsa-miR-362-5p AAUCCUUGGAACCUAGGUGUGAGU hsa-mir-362 Homo sapiens miR-362 stem-loop
hsa-miR-362-3p AACACACCUAUUCAAGGAUUCA hsa-mir-362 Homo sapiens miR-362 stem-loop
hsa-miR-3620 UCACCCUGCAUCCCGCACCCAG hsa-mir-3620 Homo sapiens miR-3620 stem-loop
hsa-miR-3621 CGCGGGUCGGGGUCUGCAGG hsa-mir-3621 Homo sapiens miR-3621 stem-loop
hsa-miR-3622a-5p CAGGCACGGGAGCUCAGGUGAG hsa-mir-3622a Homo sapiens miR-3622a stem-loop
hsa-miR-3622a-3p UCACCUGACCUCCCAUGCCUGU hsa-mir-3622a Homo sapiens miR-3622a stem-loop
hsa-miR-3622b-5p AGGCAUGGGAGGUCAGGUGA hsa-mir-3622b Homo sapiens miR-3622b stem-loop
hsa-miR-3622b-3p UCACCUGAGCUCCCGUGCCUG hsa-mir-3622b Homo sapiens miR-3622b stem-loop
hsa-miR-363* CGGGUGGAUCACGAUGCAAUUU hsa-mir-363 Homo sapiens miR-363 stem-loop
hsa-miR-363 AAUUGCACGGUAUCCAUCUGUA hsa-mir-363 Homo sapiens miR-363 stem-loop
hsa-miR-3646 AAAAUGAAAUGAGCCCAGCCCA hsa-mir-3646 Homo sapiens miR-3646 stem-loop
hsa-miR-3647-5p CUGAAGUGAUGAUUCACAUUCAU hsa-mir-3647 Homo sapiens miR-3647 stem-loop
hsa-miR-3647-3p AGAAAAUUUUUGUGUGUCUGAUC hsa-mir-3647 Homo sapiens miR-3647 stem-loop
hsa-miR-3648 AGCCGCGGGGAUCGCCGAGGG hsa-mir-3648 Homo sapiens miR-3648 stem-loop
hsa-miR-3649 AGGGACCUGAGUGUCUAAG hsa-mir-3649 Homo sapiens miR-3649 stem-loop
hsa-miR-365 UAAUGCCCCUAAAAAUCCUUAU hsa-mir-365-1 Homo sapiens miR-365-1 stem-loop
hsa-mir-365-2 Homo sapiens miR-365-2 stem-loop
hsa-miR-365* AGGGACUUUCAGGGGCAGCUGU hsa-mir-365-2 Homo sapiens miR-365-2 stem-loop
hsa-miR-3650 AGGUGUGUCUGUAGAGUCC hsa-mir-3650 Homo sapiens miR-3650 stem-loop
hsa-miR-3651 CAUAGCCCGGUCGCUGGUACAUGA hsa-mir-3651 Homo sapiens miR-3651 stem-loop
hsa-miR-3652 CGGCUGGAGGUGUGAGGA hsa-mir-3652 Homo sapiens miR-3652 stem-loop
hsa-miR-3653 CUAAGAAGUUGACUGAAG hsa-mir-3653 Homo sapiens miR-3653 stem-loop
hsa-miR-3654 GACUGGACAAGCUGAGGAA hsa-mir-3654 Homo sapiens miR-3654 stem-loop
hsa-miR-3655 GCUUGUCGCUGCGGUGUUGCU hsa-mir-3655 Homo sapiens miR-3655 stem-loop
hsa-miR-3656 GGCGGGUGCGGGGGUGG hsa-mir-3656 Homo sapiens miR-3656 stem-loop
hsa-miR-3657 UGUGUCCCAUUAUUGGUGAUU hsa-mir-3657 Homo sapiens miR-3657 stem-loop
hsa-miR-3658 UUUAAGAAAACACCAUGGAGAU hsa-mir-3658 Homo sapiens miR-3658 stem-loop
hsa-miR-3659 UGAGUGUUGUCUACGAGGGCA hsa-mir-3659 Homo sapiens miR-3659 stem-loop
hsa-miR-3660 ACUGACAGGAGAGCAUUUUGA hsa-mir-3660 Homo sapiens miR-3660 stem-loop
hsa-miR-3661 UGACCUGGGACUCGGACAGCUG hsa-mir-3661 Homo sapiens miR-3661 stem-loop
hsa-miR-3662 GAAAAUGAUGAGUAGUGACUGAUG hsa-mir-3662 Homo sapiens miR-3662 stem-loop
hsa-miR-3663-5p GCUGGUCUGCGUGGUGCUCGG hsa-mir-3663 Homo sapiens miR-3663 stem-loop
hsa-miR-3663-3p UGAGCACCACACAGGCCGGGCGC hsa-mir-3663 Homo sapiens miR-3663 stem-loop
hsa-miR-3664 AACUCUGUCUUCACUCAUGAGU hsa-mir-3664 Homo sapiens miR-3664 stem-loop
hsa-miR-3665 AGCAGGUGCGGGGCGGCG hsa-mir-3665 Homo sapiens miR-3665 stem-loop
hsa-miR-3666 CAGUGCAAGUGUAGAUGCCGA hsa-mir-3666 Homo sapiens miR-3666 stem-loop
hsa-miR-3667-5p AAAGACCCAUUGAGGAGAAGGU hsa-mir-3667 Homo sapiens miR-3667 stem-loop
hsa-miR-3667-3p ACCUUCCUCUCCAUGGGUCUUU hsa-mir-3667 Homo sapiens miR-3667 stem-loop
hsa-miR-3668 AAUGUAGAGAUUGAUCAAAAU hsa-mir-3668 Homo sapiens miR-3668 stem-loop
hsa-miR-3669 ACGGAAUAUGUAUACGGAAUAUA hsa-mir-3669 Homo sapiens miR-3669 stem-loop
hsa-miR-367* ACUGUUGCUAAUAUGCAACUCU hsa-mir-367 Homo sapiens miR-367 stem-loop
hsa-miR-367 AAUUGCACUUUAGCAAUGGUGA hsa-mir-367 Homo sapiens miR-367 stem-loop
hsa-miR-3670 AGAGCUCACAGCUGUCCUUCUCUA hsa-mir-3670 Homo sapiens miR-3670 stem-loop
hsa-miR-3671 AUCAAAUAAGGACUAGUCUGCA hsa-mir-3671 Homo sapiens miR-3671 stem-loop
hsa-miR-3672 AUGAGACUCAUGUAAAACAUCUU hsa-mir-3672 Homo sapiens miR-3672 stem-loop
hsa-miR-3673 AUGGAAUGUAUAUACGGAAUA hsa-mir-3673 Homo sapiens miR-3673 stem-loop
hsa-miR-3674 AUUGUAGAACCUAAGAUUGGCC hsa-mir-3674 Homo sapiens miR-3674 stem-loop
hsa-miR-3675-5p UAUGGGGCUUCUGUAGAGAUUUC hsa-mir-3675 Homo sapiens miR-3675 stem-loop
hsa-miR-3675-3p CAUCUCUAAGGAACUCCCCCAA hsa-mir-3675 Homo sapiens miR-3675 stem-loop
hsa-miR-3676 CCGUGUUUCCCCCACGCUUU hsa-mir-3676 Homo sapiens miR-3676 stem-loop
hsa-miR-3677 CUCGUGGGCUCUGGCCACGGCC hsa-mir-3677 Homo sapiens miR-3677 stem-loop
hsa-miR-3678-5p UCCGUACAAACUCUGCUGUG hsa-mir-3678 Homo sapiens miR-3678 stem-loop
hsa-miR-3678-3p CUGCAGAGUUUGUACGGACCGG hsa-mir-3678 Homo sapiens miR-3678 stem-loop
hsa-miR-3679-5p UGAGGAUAUGGCAGGGAAGGGGA hsa-mir-3679 Homo sapiens miR-3679 stem-loop
hsa-miR-3679-3p CUUCCCCCCAGUAAUCUUCAUC hsa-mir-3679 Homo sapiens miR-3679 stem-loop
hsa-miR-3680 GACUCACUCACAGGAUUGUGCA hsa-mir-3680 Homo sapiens miR-3680 stem-loop
hsa-miR-3680* UUUUGCAUGACCCUGGGAGUAGG hsa-mir-3680 Homo sapiens miR-3680 stem-loop
hsa-miR-3681 UAGUGGAUGAUGCACUCUGUGC hsa-mir-3681 Homo sapiens miR-3681 stem-loop
hsa-miR-3681* ACACAGUGCUUCAUCCACUACU hsa-mir-3681 Homo sapiens miR-3681 stem-loop
hsa-miR-3682 UGAUGAUACAGGUGGAGGUAG hsa-mir-3682 Homo sapiens miR-3682 stem-loop
hsa-miR-3683 UGCGACAUUGGAAGUAGUAUCA hsa-mir-3683 Homo sapiens miR-3683 stem-loop
hsa-miR-3684 UUAGACCUAGUACACGUCCUU hsa-mir-3684 Homo sapiens miR-3684 stem-loop
hsa-miR-3685 UUUCCUACCCUACCUGAAGACU hsa-mir-3685 Homo sapiens miR-3685 stem-loop
hsa-miR-3686 AUCUGUAAGAGAAAGUAAAUGA hsa-mir-3686 Homo sapiens miR-3686 stem-loop
hsa-miR-3687 CCCGGACAGGCGUUCGUGCGACGU hsa-mir-3687 Homo sapiens miR-3687 stem-loop
hsa-miR-3688 UAUGGAAAGACUUUGCCACUCU hsa-mir-3688 Homo sapiens miR-3688 stem-loop
hsa-miR-3689a-5p UGUGAUAUCAUGGUUCCUGGGA hsa-mir-3689a Homo sapiens miR-3689a stem-loop
hsa-miR-3689a-3p CUGGGAGGUGUGAUAUCGUGGU hsa-mir-3689a Homo sapiens miR-3689a stem-loop
hsa-miR-3689b UGUGAUAUCAUGGUUCCUGGGA hsa-mir-3689b Homo sapiens miR-3689b stem-loop
hsa-miR-3689b* CUGGGAGGUGUGAUAUUGUGGU hsa-mir-3689b Homo sapiens miR-3689b stem-loop
hsa-miR-369-5p AGAUCGACCGUGUUAUAUUCGC hsa-mir-369 Homo sapiens miR-369 stem-loop
hsa-miR-369-3p AAUAAUACAUGGUUGAUCUUU hsa-mir-369 Homo sapiens miR-369 stem-loop
hsa-miR-3690 ACCUGGACCCAGCGUAGACAAAG hsa-mir-3690 Homo sapiens miR-3690 stem-loop
hsa-miR-3691 AGUGGAUGAUGGAGACUCGGUAC hsa-mir-3691 Homo sapiens miR-3691 stem-loop
hsa-miR-3692* CCUGCUGGUCAGGAGUGGAUACUG hsa-mir-3692 Homo sapiens miR-3692 stem-loop
hsa-miR-3692 GUUCCACACUGACACUGCAGAAGU hsa-mir-3692 Homo sapiens miR-3692 stem-loop
hsa-miR-370 GCCUGCUGGGGUGGAACCUGGU hsa-mir-370 Homo sapiens miR-370 stem-loop
hsa-miR-371-5p ACUCAAACUGUGGGGGCACU hsa-mir-371 Homo sapiens miR-371 stem-loop
hsa-miR-371-3p AAGUGCCGCCAUCUUUUGAGUGU hsa-mir-371 Homo sapiens miR-371 stem-loop
hsa-miR-3713 GGUAUCCGUUUGGGGAUGGU hsa-mir-3713 Homo sapiens miR-3713 stem-loop
hsa-miR-3714 GAAGGCAGCAGUGCUCCCCUGU hsa-mir-3714 Homo sapiens miR-3714 stem-loop
hsa-miR-372 AAAGUGCUGCGACAUUUGAGCGU hsa-mir-372 Homo sapiens miR-372 stem-loop
hsa-miR-373* ACUCAAAAUGGGGGCGCUUUCC hsa-mir-373 Homo sapiens miR-373 stem-loop
hsa-miR-373 GAAGUGCUUCGAUUUUGGGGUGU hsa-mir-373 Homo sapiens miR-373 stem-loop
hsa-miR-374a UUAUAAUACAACCUGAUAAGUG hsa-mir-374a Homo sapiens miR-374a stem-loop
hsa-miR-374a* CUUAUCAGAUUGUAUUGUAAUU hsa-mir-374a Homo sapiens miR-374a stem-loop
hsa-miR-374b AUAUAAUACAACCUGCUAAGUG hsa-mir-374b Homo sapiens miR-374b stem-loop
hsa-miR-374b* CUUAGCAGGUUGUAUUAUCAUU hsa-mir-374b Homo sapiens miR-374b stem-loop
hsa-miR-374c AUAAUACAACCUGCUAAGUGCU hsa-mir-374c Homo sapiens miR-374c stem-loop
hsa-miR-375 UUUGUUCGUUCGGCUCGCGUGA hsa-mir-375 Homo sapiens miR-375 stem-loop
hsa-miR-376a* GUAGAUUCUCCUUCUAUGAGUA hsa-mir-376a-1 Homo sapiens miR-376a-1 stem-loop
hsa-miR-376a AUCAUAGAGGAAAAUCCACGU hsa-mir-376a-1 Homo sapiens miR-376a-1 stem-loop
hsa-mir-376a-2 Homo sapiens miR-376a-2 stem-loop
hsa-miR-376b AUCAUAGAGGAAAAUCCAUGUU hsa-mir-376b Homo sapiens miR-376b stem-loop
hsa-miR-376c AACAUAGAGGAAAUUCCACGU hsa-mir-376c Homo sapiens miR-376c stem-loop
hsa-miR-377* AGAGGUUGCCCUUGGUGAAUUC hsa-mir-377 Homo sapiens miR-377 stem-loop
hsa-miR-377 AUCACACAAAGGCAACUUUUGU hsa-mir-377 Homo sapiens miR-377 stem-loop
hsa-miR-378* CUCCUGACUCCAGGUCCUGUGU hsa-mir-378 Homo sapiens miR-378 stem-loop
hsa-miR-378 ACUGGACUUGGAGUCAGAAGG hsa-mir-378 Homo sapiens miR-378 stem-loop
hsa-miR-378b ACUGGACUUGGAGGCAGAA hsa-mir-378b Homo sapiens miR-378b stem-loop
hsa-miR-378c ACUGGACUUGGAGUCAGAAGAGUGG hsa-mir-378c Homo sapiens miR-378c stem-loop
hsa-miR-379 UGGUAGACUAUGGAACGUAGG hsa-mir-379 Homo sapiens miR-379 stem-loop
hsa-miR-379* UAUGUAACAUGGUCCACUAACU hsa-mir-379 Homo sapiens miR-379 stem-loop
hsa-miR-380* UGGUUGACCAUAGAACAUGCGC hsa-mir-380 Homo sapiens miR-380 stem-loop
hsa-miR-380 UAUGUAAUAUGGUCCACAUCUU hsa-mir-380 Homo sapiens miR-380 stem-loop
hsa-miR-381 UAUACAAGGGCAAGCUCUCUGU hsa-mir-381 Homo sapiens miR-381 stem-loop
hsa-miR-382 GAAGUUGUUCGUGGUGGAUUCG hsa-mir-382 Homo sapiens miR-382 stem-loop
hsa-miR-383 AGAUCAGAAGGUGAUUGUGGCU hsa-mir-383 Homo sapiens miR-383 stem-loop
hsa-miR-384 AUUCCUAGAAAUUGUUCAUA hsa-mir-384 Homo sapiens miR-384 stem-loop
hsa-miR-3907 AGGUGCUCCAGGCUGGCUCACA hsa-mir-3907 Homo sapiens miR-3907 stem-loop
hsa-miR-3908 GAGCAAUGUAGGUAGACUGUUU hsa-mir-3908 Homo sapiens miR-3908 stem-loop
hsa-miR-3909 UGUCCUCUAGGGCCUGCAGUCU hsa-mir-3909 Homo sapiens miR-3909 stem-loop
hsa-miR-3910 AAAGGCAUAAAACCAAGACA hsa-mir-3910-1 Homo sapiens miR-3910-1 stem-loop
hsa-mir-3910-2 Homo sapiens miR-3910-2 stem-loop
hsa-miR-3911 UGUGUGGAUCCUGGAGGAGGCA hsa-mir-3911 Homo sapiens miR-3911 stem-loop
hsa-miR-3912 UAACGCAUAAUAUGGACAUGU hsa-mir-3912 Homo sapiens miR-3912 stem-loop
hsa-miR-3913 UUUGGGACUGAUCUUGAUGUCU hsa-mir-3913-1 Homo sapiens miR-3913-1 stem-loop
hsa-mir-3913-2 Homo sapiens miR-3913-2 stem-loop
hsa-miR-3914 AAGGAACCAGAAAAUGAGAAGU hsa-mir-3914-1 Homo sapiens miR-3914-1 stem-loop
hsa-mir-3914-2 Homo sapiens miR-3914-2 stem-loop
hsa-miR-3915 UUGAGGAAAAGAUGGUCUUAUU hsa-mir-3915 Homo sapiens miR-3915 stem-loop
hsa-miR-3916 AAGAGGAAGAAAUGGCUGGUUCUCAG hsa-mir-3916 Homo sapiens miR-3916 stem-loop
hsa-miR-3917 GCUCGGACUGAGCAGGUGGG hsa-mir-3917 Homo sapiens miR-3917 stem-loop
hsa-miR-3918 ACAGGGCCGCAGAUGGAGACU hsa-mir-3918 Homo sapiens miR-3918 stem-loop
hsa-miR-3919 GCAGAGAACAAAGGACUCAGU hsa-mir-3919 Homo sapiens miR-3919 stem-loop
hsa-miR-3920 ACUGAUUAUCUUAACUCUCUGA hsa-mir-3920 Homo sapiens miR-3920 stem-loop
hsa-miR-3921 UCUCUGAGUACCAUAUGCCUUGU hsa-mir-3921 Homo sapiens miR-3921 stem-loop
hsa-miR-3922 UCUGGCCUUGACUUGACUCUUU hsa-mir-3922 Homo sapiens miR-3922 stem-loop
hsa-miR-3923 AACUAGUAAUGUUGGAUUAGGG hsa-mir-3923 Homo sapiens miR-3923 stem-loop
hsa-miR-3924 AUAUGUAUAUGUGACUGCUACU hsa-mir-3924 Homo sapiens miR-3924 stem-loop
hsa-miR-3925 AAGAGAACUGAAAGUGGAGCCU hsa-mir-3925 Homo sapiens miR-3925 stem-loop
hsa-miR-3926 UGGCCAAAAAGCAGGCAGAGA hsa-mir-3926-1 Homo sapiens miR-3926-1 stem-loop
hsa-mir-3926-2 Homo sapiens miR-3926-2 stem-loop
hsa-miR-3927 CAGGUAGAUAUUUGAUAGGCAU hsa-mir-3927 Homo sapiens miR-3927 stem-loop
hsa-miR-3928 GGAGGAACCUUGGAGCUUCGGC hsa-mir-3928 Homo sapiens miR-3928 stem-loop
hsa-miR-3929 GAGGCUGAUGUGAGUAGACCACU hsa-mir-3929 Homo sapiens miR-3929 stem-loop
hsa-miR-3934 UCAGGUGUGGAAACUGAGGCAG hsa-mir-3934 Homo sapiens miR-3934 stem-loop
hsa-miR-3935 UGUAGAUACGAGCACCAGCCAC hsa-mir-3935 Homo sapiens miR-3935 stem-loop
hsa-miR-3936 UAAGGGGUGUAUGGCAGAUGCA hsa-mir-3936 Homo sapiens miR-3936 stem-loop
hsa-miR-3937 ACAGGCGGCUGUAGCAAUGGGGG hsa-mir-3937 Homo sapiens miR-3937 stem-loop
hsa-miR-3938 AAUUCCCUUGUAGAUAACCCGG hsa-mir-3938 Homo sapiens miR-3938 stem-loop
hsa-miR-3939 UACGCGCAGACCACAGGAUGUC hsa-mir-3939 Homo sapiens miR-3939 stem-loop
hsa-miR-3940 CAGCCCGGAUCCCAGCCCACUU hsa-mir-3940 Homo sapiens miR-3940 stem-loop
hsa-miR-3941 UUACACACAACUGAGGAUCAUA hsa-mir-3941 Homo sapiens miR-3941 stem-loop
hsa-miR-3942 AAGCAAUACUGUUACCUGAAAU hsa-mir-3942 Homo sapiens miR-3942 stem-loop
hsa-miR-3943 UAGCCCCCAGGCUUCACUUGGCG hsa-mir-3943 Homo sapiens miR-3943 stem-loop
hsa-miR-3944 UUCGGGCUGGCCUGCUGCUCCGG hsa-mir-3944 Homo sapiens miR-3944 stem-loop
hsa-miR-3945 AGGGCAUAGGAGAGGGUUGAUAU hsa-mir-3945 Homo sapiens miR-3945 stem-loop
hsa-miR-409-5p AGGUUACCCGAGCAACUUUGCAU hsa-mir-409 Homo sapiens miR-409 stem-loop
hsa-miR-409-3p GAAUGUUGCUCGGUGAACCCCU hsa-mir-409 Homo sapiens miR-409 stem-loop
hsa-miR-410 AAUAUAACACAGAUGGCCUGU hsa-mir-410 Homo sapiens miR-410 stem-loop
hsa-miR-411 UAGUAGACCGUAUAGCGUACG hsa-mir-411 Homo sapiens miR-411 stem-loop
hsa-miR-411* UAUGUAACACGGUCCACUAACC hsa-mir-411 Homo sapiens miR-411 stem-loop
hsa-miR-412 ACUUCACCUGGUCCACUAGCCGU hsa-mir-412 Homo sapiens miR-412 stem-loop
hsa-miR-421 AUCAACAGACAUUAAUUGGGCGC hsa-mir-421 Homo sapiens miR-421 stem-loop
hsa-miR-422a ACUGGACUUAGGGUCAGAAGGC hsa-mir-422a Homo sapiens miR-422a stem-loop
hsa-miR-423-5p UGAGGGGCAGAGAGCGAGACUUU hsa-mir-423 Homo sapiens miR-423 stem-loop
hsa-miR-423-3p AGCUCGGUCUGAGGCCCCUCAGU hsa-mir-423 Homo sapiens miR-423 stem-loop
hsa-miR-424 CAGCAGCAAUUCAUGUUUUGAA hsa-mir-424 Homo sapiens miR-424 stem-loop
hsa-miR-424* CAAAACGUGAGGCGCUGCUAU hsa-mir-424 Homo sapiens miR-424 stem-loop
hsa-miR-425 AAUGACACGAUCACUCCCGUUGA hsa-mir-425 Homo sapiens miR-425 stem-loop
hsa-miR-425* AUCGGGAAUGUCGUGUCCGCCC hsa-mir-425 Homo sapiens miR-425 stem-loop
hsa-miR-4251 CCUGAGAAAAGGGCCAA hsa-mir-4251 Homo sapiens miR-4251 stem-loop
hsa-miR-4252 GGCCACUGAGUCAGCACCA hsa-mir-4252 Homo sapiens miR-4252 stem-loop
hsa-miR-4253 AGGGCAUGUCCAGGGGGU hsa-mir-4253 Homo sapiens miR-4253 stem-loop
hsa-miR-4254 GCCUGGAGCUACUCCACCAUCUC hsa-mir-4254 Homo sapiens miR-4254 stem-loop
hsa-miR-4255 CAGUGUUCAGAGAUGGA hsa-mir-4255 Homo sapiens miR-4255 stem-loop
hsa-miR-4256 AUCUGACCUGAUGAAGGU hsa-mir-4256 Homo sapiens miR-4256 stem-loop
hsa-miR-4257 CCAGAGGUGGGGACUGAG hsa-mir-4257 Homo sapiens miR-4257 stem-loop
hsa-miR-4258 CCCCGCCACCGCCUUGG hsa-mir-4258 Homo sapiens miR-4258 stem-loop
hsa-miR-4259 CAGUUGGGUCUAGGGGUCAGGA hsa-mir-4259 Homo sapiens miR-4259 stem-loop
hsa-miR-4260 CUUGGGGCAUGGAGUCCCA hsa-mir-4260 Homo sapiens miR-4260 stem-loop
hsa-miR-4261 AGGAAACAGGGACCCA hsa-mir-4261 Homo sapiens miR-4261 stem-loop
hsa-miR-4262 GACAUUCAGACUACCUG hsa-mir-4262 Homo sapiens miR-4262 stem-loop
hsa-miR-4263 AUUCUAAGUGCCUUGGCC hsa-mir-4263 Homo sapiens miR-4263 stem-loop
hsa-miR-4264 ACUCAGUCAUGGUCAUU hsa-mir-4264 Homo sapiens miR-4264 stem-loop
hsa-miR-4265 CUGUGGGCUCAGCUCUGGG hsa-mir-4265 Homo sapiens miR-4265 stem-loop
hsa-miR-4266 CUAGGAGGCCUUGGCC hsa-mir-4266 Homo sapiens miR-4266 stem-loop
hsa-miR-4267 UCCAGCUCGGUGGCAC hsa-mir-4267 Homo sapiens miR-4267 stem-loop
hsa-miR-4268 GGCUCCUCCUCUCAGGAUGUG hsa-mir-4268 Homo sapiens miR-4268 stem-loop
hsa-miR-4269 GCAGGCACAGACAGCCCUGGC hsa-mir-4269 Homo sapiens miR-4269 stem-loop
hsa-miR-4270 UCAGGGAGUCAGGGGAGGGC hsa-mir-4270 Homo sapiens miR-4270 stem-loop
hsa-miR-4271 GGGGGAAGAAAAGGUGGGG hsa-mir-4271 Homo sapiens miR-4271 stem-loop
hsa-miR-4272 CAUUCAACUAGUGAUUGU hsa-mir-4272 Homo sapiens miR-4272 stem-loop
hsa-miR-4273 GUGUUCUCUGAUGGACAG hsa-mir-4273 Homo sapiens miR-4273 stem-loop
hsa-miR-4274 CAGCAGUCCCUCCCCCUG hsa-mir-4274 Homo sapiens miR-4274 stem-loop
hsa-miR-4275 CCAAUUACCACUUCUUU hsa-mir-4275 Homo sapiens miR-4275 stem-loop
hsa-miR-4276 CUCAGUGACUCAUGUGC hsa-mir-4276 Homo sapiens miR-4276 stem-loop
hsa-miR-4277 GCAGUUCUGAGCACAGUACAC hsa-mir-4277 Homo sapiens miR-4277 stem-loop
hsa-miR-4278 CUAGGGGGUUUGCCCUUG hsa-mir-4278 Homo sapiens miR-4278 stem-loop
hsa-miR-4279 CUCUCCUCCCGGCUUC hsa-mir-4279 Homo sapiens miR-4279 stem-loop
hsa-miR-4280 GAGUGUAGUUCUGAGCAGAGC hsa-mir-4280 Homo sapiens miR-4280 stem-loop
hsa-miR-4281 GGGUCCCGGGGAGGGGGG hsa-mir-4281 Homo sapiens miR-4281 stem-loop
hsa-miR-4282 UAAAAUUUGCAUCCAGGA hsa-mir-4282 Homo sapiens miR-4282 stem-loop
hsa-miR-4283 UGGGGCUCAGCGAGUUU hsa-mir-4283-1 Homo sapiens miR-4283-1 stem-loop
hsa-mir-4283-2 Homo sapiens miR-4283-2 stem-loop
hsa-miR-4284 GGGCUCACAUCACCCCAU hsa-mir-4284 Homo sapiens miR-4284 stem-loop
hsa-miR-4285 GCGGCGAGUCCGACUCAU hsa-mir-4285 Homo sapiens miR-4285 stem-loop
hsa-miR-4286 ACCCCACUCCUGGUACC hsa-mir-4286 Homo sapiens miR-4286 stem-loop
hsa-miR-4287 UCUCCCUUGAGGGCACUUU hsa-mir-4287 Homo sapiens miR-4287 stem-loop
hsa-miR-4288 UUGUCUGCUGAGUUUCC hsa-mir-4288 Homo sapiens miR-4288 stem-loop
hsa-miR-4289 GCAUUGUGCAGGGCUAUCA hsa-mir-4289 Homo sapiens miR-4289 stem-loop
hsa-miR-429 UAAUACUGUCUGGUAAAACCGU hsa-mir-429 Homo sapiens miR-429 stem-loop
hsa-miR-4290 UGCCCUCCUUUCUUCCCUC hsa-mir-4290 Homo sapiens miR-4290 stem-loop
hsa-miR-4291 UUCAGCAGGAACAGCU hsa-mir-4291 Homo sapiens miR-4291 stem-loop
hsa-miR-4292 CCCCUGGGCCGGCCUUGG hsa-mir-4292 Homo sapiens miR-4292 stem-loop
hsa-miR-4293 CAGCCUGACAGGAACAG hsa-mir-4293 Homo sapiens miR-4293 stem-loop
hsa-miR-4294 GGGAGUCUACAGCAGGG hsa-mir-4294 Homo sapiens miR-4294 stem-loop
hsa-miR-4295 CAGUGCAAUGUUUUCCUU hsa-mir-4295 Homo sapiens miR-4295 stem-loop
hsa-miR-4296 AUGUGGGCUCAGGCUCA hsa-mir-4296 Homo sapiens miR-4296 stem-loop
hsa-miR-4297 UGCCUUCCUGUCUGUG hsa-mir-4297 Homo sapiens miR-4297 stem-loop
hsa-miR-4298 CUGGGACAGGAGGAGGAGGCAG hsa-mir-4298 Homo sapiens miR-4298 stem-loop
hsa-miR-4299 GCUGGUGACAUGAGAGGC hsa-mir-4299 Homo sapiens miR-4299 stem-loop
hsa-miR-4300 UGGGAGCUGGACUACUUC hsa-mir-4300 Homo sapiens miR-4300 stem-loop
hsa-miR-4301 UCCCACUACUUCACUUGUGA hsa-mir-4301 Homo sapiens miR-4301 stem-loop
hsa-miR-4302 CCAGUGUGGCUCAGCGAG hsa-mir-4302 Homo sapiens miR-4302 stem-loop
hsa-miR-4303 UUCUGAGCUGAGGACAG hsa-mir-4303 Homo sapiens miR-4303 stem-loop
hsa-miR-4304 CCGGCAUGUCCAGGGCA hsa-mir-4304 Homo sapiens miR-4304 stem-loop
hsa-miR-4305 CCUAGACACCUCCAGUUC hsa-mir-4305 Homo sapiens miR-4305 stem-loop
hsa-miR-4306 UGGAGAGAAAGGCAGUA hsa-mir-4306 Homo sapiens miR-4306 stem-loop
hsa-miR-4307 AAUGUUUUUUCCUGUUUCC hsa-mir-4307 Homo sapiens miR-4307 stem-loop
hsa-miR-4308 UCCCUGGAGUUUCUUCUU hsa-mir-4308 Homo sapiens miR-4308 stem-loop
hsa-miR-4309 CUGGAGUCUAGGAUUCCA hsa-mir-4309 Homo sapiens miR-4309 stem-loop
hsa-miR-431 UGUCUUGCAGGCCGUCAUGCA hsa-mir-431 Homo sapiens miR-431 stem-loop
hsa-miR-431* CAGGUCGUCUUGCAGGGCUUCU hsa-mir-431 Homo sapiens miR-431 stem-loop
hsa-miR-4310 GCAGCAUUCAUGUCCC hsa-mir-4310 Homo sapiens miR-4310 stem-loop
hsa-miR-4311 GAAAGAGAGCUGAGUGUG hsa-mir-4311 Homo sapiens miR-4311 stem-loop
hsa-miR-4312 GGCCUUGUUCCUGUCCCCA hsa-mir-4312 Homo sapiens miR-4312 stem-loop
hsa-miR-4313 AGCCCCCUGGCCCCAAACCC hsa-mir-4313 Homo sapiens miR-4313 stem-loop
hsa-miR-4314 CUCUGGGAAAUGGGACAG hsa-mir-4314 Homo sapiens miR-4314 stem-loop
hsa-miR-4315 CCGCUUUCUGAGCUGGAC hsa-mir-4315-1 Homo sapiens miR-4315-1 stem-loop
hsa-mir-4315-2 Homo sapiens miR-4315-2 stem-loop
hsa-miR-4316 GGUGAGGCUAGCUGGUG hsa-mir-4316 Homo sapiens miR-4316 stem-loop
hsa-miR-4317 ACAUUGCCAGGGAGUUU hsa-mir-4317 Homo sapiens miR-4317 stem-loop
hsa-miR-4318 CACUGUGGGUACAUGCU hsa-mir-4318 Homo sapiens miR-4318 stem-loop
hsa-miR-4319 UCCCUGAGCAAAGCCAC hsa-mir-4319 Homo sapiens miR-4319 stem-loop
hsa-miR-432 UCUUGGAGUAGGUCAUUGGGUGG hsa-mir-432 Homo sapiens miR-432 stem-loop
hsa-miR-432* CUGGAUGGCUCCUCCAUGUCU hsa-mir-432 Homo sapiens miR-432 stem-loop
hsa-miR-4320 GGGAUUCUGUAGCUUCCU hsa-mir-4320 Homo sapiens miR-4320 stem-loop
hsa-miR-4321 UUAGCGGUGGACCGCCCUGCG hsa-mir-4321 Homo sapiens miR-4321 stem-loop
hsa-miR-4322 CUGUGGGCUCAGCGCGUGGGG hsa-mir-4322 Homo sapiens miR-4322 stem-loop
hsa-miR-4323 CAGCCCCACAGCCUCAGA hsa-mir-4323 Homo sapiens miR-4323 stem-loop
hsa-miR-4324 CCCUGAGACCCUAACCUUAA hsa-mir-4324 Homo sapiens miR-4324 stem-loop
hsa-miR-4325 UUGCACUUGUCUCAGUGA hsa-mir-4325 Homo sapiens miR-4325 stem-loop
hsa-miR-4326 UGUUCCUCUGUCUCCCAGAC hsa-mir-4326 Homo sapiens miR-4326 stem-loop
hsa-miR-4327 GGCUUGCAUGGGGGACUGG hsa-mir-4327 Homo sapiens miR-4327 stem-loop
hsa-miR-4328 CCAGUUUUCCCAGGAUU hsa-mir-4328 Homo sapiens miR-4328 stem-loop
hsa-miR-4329 CCUGAGACCCUAGUUCCAC hsa-mir-4329 Homo sapiens miR-4329 stem-loop
hsa-miR-433 AUCAUGAUGGGCUCCUCGGUGU hsa-mir-433 Homo sapiens miR-433 stem-loop
hsa-miR-4330 CCUCAGAUCAGAGCCUUGC hsa-mir-4330 Homo sapiens miR-4330 stem-loop
hsa-miR-448 UUGCAUAUGUAGGAUGUCCCAU hsa-mir-448 Homo sapiens miR-448 stem-loop
hsa-miR-449a UGGCAGUGUAUUGUUAGCUGGU hsa-mir-449a Homo sapiens miR-449a stem-loop
hsa-miR-449b AGGCAGUGUAUUGUUAGCUGGC hsa-mir-449b Homo sapiens miR-449b stem-loop
hsa-miR-449b* CAGCCACAACUACCCUGCCACU hsa-mir-449b Homo sapiens miR-449b stem-loop
hsa-miR-449c UAGGCAGUGUAUUGCUAGCGGCUGU hsa-mir-449c Homo sapiens mir-449c stem-loop
hsa-miR-449c* UUGCUAGUUGCACUCCUCUCUGU hsa-mir-449c Homo sapiens mir-449c stem-loop
hsa-miR-450a UUUUGCGAUGUGUUCCUAAUAU hsa-mir-450a-1 Homo sapiens miR-450a-1 stem-loop
hsa-mir-450a-2 Homo sapiens miR-450a-2 stem-loop
hsa-miR-450b-5p UUUUGCAAUAUGUUCCUGAAUA hsa-mir-450b Homo sapiens miR-450b stem-loop
hsa-miR-450b-3p UUGGGAUCAUUUUGCAUCCAUA hsa-mir-450b Homo sapiens miR-450b stem-loop
hsa-miR-451 AAACCGUUACCAUUACUGAGUU hsa-mir-451 Homo sapiens miR-451 stem-loop
hsa-miR-452 AACUGUUUGCAGAGGAAACUGA hsa-mir-452 Homo sapiens miR-452 stem-loop
hsa-miR-452* CUCAUCUGCAAAGAAGUAAGUG hsa-mir-452 Homo sapiens miR-452 stem-loop
hsa-miR-454* ACCCUAUCAAUAUUGUCUCUGC hsa-mir-454 Homo sapiens miR-454 stem-loop
hsa-miR-454 UAGUGCAAUAUUGCUUAUAGGGU hsa-mir-454 Homo sapiens miR-454 stem-loop
hsa-miR-455-5p UAUGUGCCUUUGGACUACAUCG hsa-mir-455 Homo sapiens miR-455 stem-loop
hsa-miR-455-3p GCAGUCCAUGGGCAUAUACAC hsa-mir-455 Homo sapiens miR-455 stem-loop
hsa-miR-466 AUACACAUACACGCAACACACAU hsa-mir-466 Homo sapiens miR-466 stem-loop
hsa-miR-483-5p AAGACGGGAGGAAAGAAGGGAG hsa-mir-483 Homo sapiens miR-483 stem-loop
hsa-miR-483-3p UCACUCCUCUCCUCCCGUCUU hsa-mir-483 Homo sapiens miR-483 stem-loop
hsa-miR-484 UCAGGCUCAGUCCCCUCCCGAU hsa-mir-484 Homo sapiens miR-484 stem-loop
hsa-miR-485-5p AGAGGCUGGCCGUGAUGAAUUC hsa-mir-485 Homo sapiens miR-485 stem-loop
hsa-miR-485-3p GUCAUACACGGCUCUCCUCUCU hsa-mir-485 Homo sapiens miR-485 stem-loop
hsa-miR-486-5p UCCUGUACUGAGCUGCCCCGAG hsa-mir-486 Homo sapiens miR-486 stem-loop
hsa-miR-486-3p CGGGGCAGCUCAGUACAGGAU hsa-mir-486 Homo sapiens miR-486 stem-loop
hsa-miR-487a AAUCAUACAGGGACAUCCAGUU hsa-mir-487a Homo sapiens miR-487a stem-loop
hsa-miR-487b AAUCGUACAGGGUCAUCCACUU hsa-mir-487b Homo sapiens miR-487b stem-loop
hsa-miR-488* CCCAGAUAAUGGCACUCUCAA hsa-mir-488 Homo sapiens miR-488 stem-loop
hsa-miR-488 UUGAAAGGCUAUUUCUUGGUC hsa-mir-488 Homo sapiens miR-488 stem-loop
hsa-miR-489 GUGACAUCACAUAUACGGCAGC hsa-mir-489 Homo sapiens miR-489 stem-loop
hsa-miR-490-5p CCAUGGAUCUCCAGGUGGGU hsa-mir-490 Homo sapiens miR-490 stem-loop
hsa-miR-490-3p CAACCUGGAGGACUCCAUGCUG hsa-mir-490 Homo sapiens miR-490 stem-loop
hsa-miR-491-5p AGUGGGGAACCCUUCCAUGAGG hsa-mir-491 Homo sapiens miR-491 stem-loop
hsa-miR-491-3p CUUAUGCAAGAUUCCCUUCUAC hsa-mir-491 Homo sapiens miR-491 stem-loop
hsa-miR-492 AGGACCUGCGGGACAAGAUUCUU hsa-mir-492 Homo sapiens miR-492 stem-loop
hsa-miR-493* UUGUACAUGGUAGGCUUUCAUU hsa-mir-493 Homo sapiens miR-493 stem-loop
hsa-miR-493 UGAAGGUCUACUGUGUGCCAGG hsa-mir-493 Homo sapiens miR-493 stem-loop
hsa-miR-494 UGAAACAUACACGGGAAACCUC hsa-mir-494 Homo sapiens miR-494 stem-loop
hsa-miR-495 AAACAAACAUGGUGCACUUCUU hsa-mir-495 Homo sapiens miR-495 stem-loop
hsa-miR-496 UGAGUAUUACAUGGCCAAUCUC hsa-mir-496 Homo sapiens miR-496 stem-loop
hsa-miR-497 CAGCAGCACACUGUGGUUUGU hsa-mir-497 Homo sapiens miR-497 stem-loop
hsa-miR-497* CAAACCACACUGUGGUGUUAGA hsa-mir-497 Homo sapiens miR-497 stem-loop
hsa-miR-498 UUUCAAGCCAGGGGGCGUUUUUC hsa-mir-498 Homo sapiens miR-498 stem-loop
hsa-miR-499-5p UUAAGACUUGCAGUGAUGUUU hsa-mir-499 Homo sapiens miR-499 stem-loop
hsa-miR-499-3p AACAUCACAGCAAGUCUGUGCU hsa-mir-499 Homo sapiens miR-499 stem-loop
hsa-miR-500a UAAUCCUUGCUACCUGGGUGAGA hsa-mir-500a Homo sapiens miR-500a stem-loop
hsa-miR-500a* AUGCACCUGGGCAAGGAUUCUG hsa-mir-500a Homo sapiens miR-500a stem-loop
hsa-miR-500b AAUCCUUGCUACCUGGGU hsa-mir-500b Homo sapiens miR-500b stem-loop
hsa-miR-501-5p AAUCCUUUGUCCCUGGGUGAGA hsa-mir-501 Homo sapiens miR-501 stem-loop
hsa-miR-501-3p AAUGCACCCGGGCAAGGAUUCU hsa-mir-501 Homo sapiens miR-501 stem-loop
hsa-miR-502-5p AUCCUUGCUAUCUGGGUGCUA hsa-mir-502 Homo sapiens miR-502 stem-loop
hsa-miR-502-3p AAUGCACCUGGGCAAGGAUUCA hsa-mir-502 Homo sapiens miR-502 stem-loop
hsa-miR-503 UAGCAGCGGGAACAGUUCUGCAG hsa-mir-503 Homo sapiens miR-503 stem-loop
hsa-miR-504 AGACCCUGGUCUGCACUCUAUC hsa-mir-504 Homo sapiens miR-504 stem-loop
hsa-miR-505* GGGAGCCAGGAAGUAUUGAUGU hsa-mir-505 Homo sapiens miR-505 stem-loop
hsa-miR-505 CGUCAACACUUGCUGGUUUCCU hsa-mir-505 Homo sapiens miR-505 stem-loop
hsa-miR-506 UAAGGCACCCUUCUGAGUAGA hsa-mir-506 Homo sapiens miR-506 stem-loop
hsa-miR-507 UUUUGCACCUUUUGGAGUGAA hsa-mir-507 Homo sapiens miR-507 stem-loop
hsa-miR-508-5p UACUCCAGAGGGCGUCACUCAUG hsa-mir-508 Homo sapiens miR-508 stem-loop
hsa-miR-508-3p UGAUUGUAGCCUUUUGGAGUAGA hsa-mir-508 Homo sapiens miR-508 stem-loop
hsa-miR-509-5p UACUGCAGACAGUGGCAAUCA hsa-mir-509-1 Homo sapiens miR-509-1 stem-loop
hsa-mir-509-2 Homo sapiens miR-509-2 stem-loop
hsa-miR-509-3p UGAUUGGUACGUCUGUGGGUAG hsa-mir-509-1 Homo sapiens miR-509-1 stem-loop
hsa-mir-509-2 Homo sapiens miR-509-2 stem-loop
hsa-mir-509-3 Homo sapiens miR-509-3 stem-loop
hsa-miR-509-3-5p UACUGCAGACGUGGCAAUCAUG hsa-mir-509-3 Homo sapiens miR-509-3 stem-loop
hsa-miR-510 UACUCAGGAGAGUGGCAAUCAC hsa-mir-510 Homo sapiens miR-510 stem-loop
hsa-miR-511 GUGUCUUUUGCUCUGCAGUCA hsa-mir-511-1 Homo sapiens miR-511-1 stem-loop
hsa-mir-511-2 Homo sapiens miR-511-2 stem-loop
hsa-miR-512-5p CACUCAGCCUUGAGGGCACUUUC hsa-mir-512-1 Homo sapiens miR-512-1 stem-loop
hsa-mir-512-2 Homo sapiens miR-512-2 stem-loop
hsa-miR-512-3p AAGUGCUGUCAUAGCUGAGGUC hsa-mir-512-1 Homo sapiens miR-512-1 stem-loop
hsa-mir-512-2 Homo sapiens miR-512-2 stem-loop
hsa-miR-513a-5p UUCACAGGGAGGUGUCAU hsa-mir-513a-1 Homo sapiens miR-513a-1 stem-loop
hsa-mir-513a-2 Homo sapiens miR-513a-2 stem-loop
hsa-miR-513a-3p UAAAUUUCACCUUUCUGAGAAGG hsa-mir-513a-1 Homo sapiens miR-513a-1 stem-loop
hsa-mir-513a-2 Homo sapiens miR-513a-2 stem-loop
hsa-miR-513b UUCACAAGGAGGUGUCAUUUAU hsa-mir-513b Homo sapiens miR-513b stem-loop
hsa-miR-513c UUCUCAAGGAGGUGUCGUUUAU hsa-mir-513c Homo sapiens miR-513c stem-loop
hsa-miR-514 AUUGACACUUCUGUGAGUAGA hsa-mir-514-1 Homo sapiens miR-514-1 stem-loop
hsa-mir-514-2 Homo sapiens miR-514-2 stem-loop
hsa-mir-514-3 Homo sapiens miR-514-3 stem-loop
hsa-miR-514b-5p UUCUCAAGAGGGAGGCAAUCAU hsa-mir-514b Homo sapiens miR-514b stem-loop
hsa-miR-514b-3p AUUGACACCUCUGUGAGUGGA hsa-mir-514b Homo sapiens miR-514b stem-loop
hsa-miR-515-5p UUCUCCAAAAGAAAGCACUUUCUG hsa-mir-515-1 Homo sapiens miR-515-1 stem-loop
hsa-mir-515-2 Homo sapiens miR-515-2 stem-loop
hsa-miR-515-3p GAGUGCCUUCUUUUGGAGCGUU hsa-mir-515-1 Homo sapiens miR-515-1 stem-loop
hsa-mir-515-2 Homo sapiens miR-515-2 stem-loop
hsa-miR-516a-5p UUCUCGAGGAAAGAAGCACUUUC hsa-mir-516a-1 Homo sapiens miR-516a-1 stem-loop
hsa-mir-516a-2 Homo sapiens miR-516a-2 stem-loop
hsa-miR-516a-3p UGCUUCCUUUCAGAGGGU hsa-mir-516a-1 Homo sapiens miR-516a-1 stem-loop
hsa-mir-516a-2 Homo sapiens miR-516a-2 stem-loop
hsa-miR-516b AUCUGGAGGUAAGAAGCACUUU hsa-mir-516b-1 Homo sapiens miR-516b-1 stem-loop
hsa-mir-516b-2 Homo sapiens miR-516b-2 stem-loop
hsa-miR-516b* UGCUUCCUUUCAGAGGGU hsa-mir-516b-1 Homo sapiens miR-516b-1 stem-loop
hsa-mir-516b-2 Homo sapiens miR-516b-2 stem-loop
hsa-miR-517* CCUCUAGAUGGAAGCACUGUCU hsa-mir-517a Homo sapiens miR-517a stem-loop
hsa-mir-517b Homo sapiens miR-517b stem-loop
hsa-mir-517c Homo sapiens miR-517c stem-loop
hsa-miR-517a AUCGUGCAUCCCUUUAGAGUGU hsa-mir-517a Homo sapiens miR-517a stem-loop
hsa-miR-517b UCGUGCAUCCCUUUAGAGUGUU hsa-mir-517b Homo sapiens miR-517b stem-loop
hsa-miR-517c AUCGUGCAUCCUUUUAGAGUGU hsa-mir-517c Homo sapiens miR-517c stem-loop
hsa-miR-518a-5p CUGCAAAGGGAAGCCCUUUC hsa-mir-518a-1 Homo sapiens miR-518a-1 stem-loop
hsa-mir-518a-2 Homo sapiens miR-518a-2 stem-loop
hsa-miR-518a-3p GAAAGCGCUUCCCUUUGCUGGA hsa-mir-518a-1 Homo sapiens miR-518a-1 stem-loop
hsa-mir-518a-2 Homo sapiens miR-518a-2 stem-loop
hsa-miR-518b CAAAGCGCUCCCCUUUAGAGGU hsa-mir-518b Homo sapiens miR-518b stem-loop
hsa-miR-518c* UCUCUGGAGGGAAGCACUUUCUG hsa-mir-518c Homo sapiens miR-518c stem-loop
hsa-miR-518c CAAAGCGCUUCUCUUUAGAGUGU hsa-mir-518c Homo sapiens miR-518c stem-loop
hsa-miR-518d-5p CUCUAGAGGGAAGCACUUUCUG hsa-mir-518d Homo sapiens miR-518d stem-loop
hsa-miR-518d-3p CAAAGCGCUUCCCUUUGGAGC hsa-mir-518d Homo sapiens miR-518d stem-loop
hsa-miR-518e* CUCUAGAGGGAAGCGCUUUCUG hsa-mir-518e Homo sapiens miR-518e stem-loop
hsa-miR-518e AAAGCGCUUCCCUUCAGAGUG hsa-mir-518e Homo sapiens miR-518e stem-loop
hsa-miR-518f* CUCUAGAGGGAAGCACUUUCUC hsa-mir-518f Homo sapiens miR-518f stem-loop
hsa-miR-518f GAAAGCGCUUCUCUUUAGAGG hsa-mir-518f Homo sapiens miR-518f stem-loop
hsa-miR-519a* CUCUAGAGGGAAGCGCUUUCUG hsa-mir-519a-1 Homo sapiens miR-519a-1 stem-loop
hsa-miR-519a AAAGUGCAUCCUUUUAGAGUGU hsa-mir-519a-1 Homo sapiens miR-519a-1 stem-loop
hsa-mir-519a-2 Homo sapiens miR-519a-2 stem-loop
hsa-miR-519b-5p CUCUAGAGGGAAGCGCUUUCUG hsa-mir-519b Homo sapiens miR-519b stem-loop
hsa-miR-519b-3p AAAGUGCAUCCUUUUAGAGGUU hsa-mir-519b Homo sapiens miR-519b stem-loop
hsa-miR-519c-5p CUCUAGAGGGAAGCGCUUUCUG hsa-mir-519c Homo sapiens miR-519c stem-loop
hsa-miR-519c-3p AAAGUGCAUCUUUUUAGAGGAU hsa-mir-519c Homo sapiens miR-519c stem-loop
hsa-miR-519d CAAAGUGCCUCCCUUUAGAGUG hsa-mir-519d Homo sapiens miR-519d stem-loop
hsa-miR-519e* UUCUCCAAAAGGGAGCACUUUC hsa-mir-519e Homo sapiens miR-519e stem-loop
hsa-miR-519e AAGUGCCUCCUUUUAGAGUGUU hsa-mir-519e Homo sapiens miR-519e stem-loop
hsa-miR-520a-5p CUCCAGAGGGAAGUACUUUCU hsa-mir-520a Homo sapiens miR-520a stem-loop
hsa-miR-520a-3p AAAGUGCUUCCCUUUGGACUGU hsa-mir-520a Homo sapiens miR-520a stem-loop
hsa-miR-520b AAAGUGCUUCCUUUUAGAGGG hsa-mir-520b Homo sapiens miR-520b stem-loop
hsa-miR-520c-5p CUCUAGAGGGAAGCACUUUCUG hsa-mir-520c Homo sapiens miR-520c stem-loop
hsa-miR-520c-3p AAAGUGCUUCCUUUUAGAGGGU hsa-mir-520c Homo sapiens miR-520c stem-loop
hsa-miR-520d-5p CUACAAAGGGAAGCCCUUUC hsa-mir-520d Homo sapiens miR-520d stem-loop
hsa-miR-520d-3p AAAGUGCUUCUCUUUGGUGGGU hsa-mir-520d Homo sapiens miR-520d stem-loop
hsa-miR-520e AAAGUGCUUCCUUUUUGAGGG hsa-mir-520e Homo sapiens miR-520e stem-loop
hsa-miR-520f AAGUGCUUCCUUUUAGAGGGUU hsa-mir-520f Homo sapiens miR-520f stem-loop
hsa-miR-520g ACAAAGUGCUUCCCUUUAGAGUGU hsa-mir-520g Homo sapiens miR-520g stem-loop
hsa-miR-520h ACAAAGUGCUUCCCUUUAGAGU hsa-mir-520h Homo sapiens miR-520h stem-loop
hsa-miR-521 AACGCACUUCCCUUUAGAGUGU hsa-mir-521-1 Homo sapiens miR-521-1 stem-loop
hsa-mir-521-2 Homo sapiens miR-521-2 stem-loop
hsa-miR-522* CUCUAGAGGGAAGCGCUUUCUG hsa-mir-522 Homo sapiens miR-522 stem-loop
hsa-miR-522 AAAAUGGUUCCCUUUAGAGUGU hsa-mir-522 Homo sapiens miR-522 stem-loop
hsa-miR-523* CUCUAGAGGGAAGCGCUUUCUG hsa-mir-523 Homo sapiens miR-523 stem-loop
hsa-miR-523 GAACGCGCUUCCCUAUAGAGGGU hsa-mir-523 Homo sapiens miR-523 stem-loop
hsa-miR-524-5p CUACAAAGGGAAGCACUUUCUC hsa-mir-524 Homo sapiens miR-524 stem-loop
hsa-miR-524-3p GAAGGCGCUUCCCUUUGGAGU hsa-mir-524 Homo sapiens miR-524 stem-loop
hsa-miR-525-5p CUCCAGAGGGAUGCACUUUCU hsa-mir-525 Homo sapiens miR-525 stem-loop
hsa-miR-525-3p GAAGGCGCUUCCCUUUAGAGCG hsa-mir-525 Homo sapiens miR-525 stem-loop
hsa-miR-526a CUCUAGAGGGAAGCACUUUCUG hsa-mir-526a-1 Homo sapiens miR-526a-1 stem-loop
hsa-mir-526a-2 Homo sapiens miR-526a-2 stem-loop
hsa-miR-526b CUCUUGAGGGAAGCACUUUCUGU hsa-mir-526b Homo sapiens miR-526b stem-loop
hsa-miR-526b* GAAAGUGCUUCCUUUUAGAGGC hsa-mir-526b Homo sapiens miR-526b stem-loop
hsa-miR-527 CUGCAAAGGGAAGCCCUUUC hsa-mir-527 Homo sapiens miR-527 stem-loop
hsa-miR-532-5p CAUGCCUUGAGUGUAGGACCGU hsa-mir-532 Homo sapiens miR-532 stem-loop
hsa-miR-532-3p CCUCCCACACCCAAGGCUUGCA hsa-mir-532 Homo sapiens miR-532 stem-loop
hsa-miR-539 GGAGAAAUUAUCCUUGGUGUGU hsa-mir-539 Homo sapiens miR-539 stem-loop
hsa-miR-541* AAAGGAUUCUGCUGUCGGUCCCACU hsa-mir-541 Homo sapiens miR-541 stem-loop
hsa-miR-541 UGGUGGGCACAGAAUCUGGACU hsa-mir-541 Homo sapiens miR-541 stem-loop
hsa-miR-542-5p UCGGGGAUCAUCAUGUCACGAGA hsa-mir-542 Homo sapiens miR-542 stem-loop
hsa-miR-542-3p UGUGACAGAUUGAUAACUGAAA hsa-mir-542 Homo sapiens miR-542 stem-loop
hsa-miR-543 AAACAUUCGCGGUGCACUUCUU hsa-mir-543 Homo sapiens miR-543 stem-loop
hsa-miR-544 AUUCUGCAUUUUUAGCAAGUUC hsa-mir-544 Homo sapiens miR-544 stem-loop
hsa-miR-544b ACCUGAGGUUGUGCAUUUCUAA hsa-mir-544b Homo sapiens miR-544b stem-loop
hsa-miR-545* UCAGUAAAUGUUUAUUAGAUGA hsa-mir-545 Homo sapiens miR-545 stem-loop
hsa-miR-545 UCAGCAAACAUUUAUUGUGUGC hsa-mir-545 Homo sapiens miR-545 stem-loop
hsa-miR-548a-3p CAAAACUGGCAAUUACUUUUGC hsa-mir-548a-1 Homo sapiens miR-548a-1 stem-loop
hsa-mir-548a-2 Homo sapiens miR-548a-2 stem-loop
hsa-mir-548a-3 Homo sapiens miR-548a-3 stem-loop
hsa-miR-548a-5p AAAAGUAAUUGCGAGUUUUACC hsa-mir-548a-3 Homo sapiens miR-548a-3 stem-loop
hsa-miR-548aa AAAAACCACAAUUACUUUUGCACCA hsa-mir-548aa-1 Homo sapiens miR-548aa-1 stem-loop
hsa-mir-548aa-2 Homo sapiens miR-548aa-2 stem-loop
hsa-miR-548b-5p AAAAGUAAUUGUGGUUUUGGCC hsa-mir-548b Homo sapiens miR-548b stem-loop
hsa-miR-548b-3p CAAGAACCUCAGUUGCUUUUGU hsa-mir-548b Homo sapiens miR-548b stem-loop
hsa-miR-548c-5p AAAAGUAAUUGCGGUUUUUGCC hsa-mir-548c Homo sapiens miR-548c stem-loop
hsa-miR-548c-3p CAAAAAUCUCAAUUACUUUUGC hsa-mir-548c Homo sapiens miR-548c stem-loop
hsa-miR-548d-5p AAAAGUAAUUGUGGUUUUUGCC hsa-mir-548d-1 Homo sapiens miR-548d-1 stem-loop
hsa-mir-548d-2 Homo sapiens miR-548d-2 stem-loop
hsa-miR-548d-3p CAAAAACCACAGUUUCUUUUGC hsa-mir-548d-1 Homo sapiens miR-548d-1 stem-loop
hsa-mir-548d-2 Homo sapiens miR-548d-2 stem-loop
hsa-miR-548e AAAAACUGAGACUACUUUUGCA hsa-mir-548e Homo sapiens miR-548e stem-loop
hsa-miR-548f AAAAACUGUAAUUACUUUU hsa-mir-548f-1 Homo sapiens miR-548f-1 stem-loop
hsa-mir-548f-2 Homo sapiens miR-548f-2 stem-loop
hsa-mir-548f-3 Homo sapiens miR-548f-3 stem-loop
hsa-mir-548f-4 Homo sapiens miR-548f-4 stem-loop
hsa-mir-548f-5 Homo sapiens miR-548f-5 stem-loop
hsa-miR-548g AAAACUGUAAUUACUUUUGUAC hsa-mir-548g Homo sapiens miR-548g stem-loop
hsa-miR-548h AAAAGUAAUCGCGGUUUUUGUC hsa-mir-548h-1 Homo sapiens miR-548h-1 stem-loop
hsa-mir-548h-2 Homo sapiens miR-548h-2 stem-loop
hsa-mir-548h-3 Homo sapiens miR-548h-3 stem-loop
hsa-mir-548h-4 Homo sapiens miR-548h-4 stem-loop
hsa-miR-548i AAAAGUAAUUGCGGAUUUUGCC hsa-mir-548i-1 Homo sapiens miR-548i-1 stem-loop
hsa-mir-548i-2 Homo sapiens miR-548i-2 stem-loop
hsa-mir-548i-3 Homo sapiens miR-548i-3 stem-loop
hsa-mir-548i-4 Homo sapiens miR-548i-4 stem-loop
hsa-miR-548j AAAAGUAAUUGCGGUCUUUGGU hsa-mir-548j Homo sapiens miR-548j stem-loop
hsa-miR-548k AAAAGUACUUGCGGAUUUUGCU hsa-mir-548k Homo sapiens miR-548k stem-loop
hsa-miR-548l AAAAGUAUUUGCGGGUUUUGUC hsa-mir-548l Homo sapiens miR-548l stem-loop
hsa-miR-548m CAAAGGUAUUUGUGGUUUUUG hsa-mir-548m Homo sapiens miR-548m stem-loop
hsa-miR-548n CAAAAGUAAUUGUGGAUUUUGU hsa-mir-548n Homo sapiens miR-548n stem-loop
hsa-miR-548o CCAAAACUGCAGUUACUUUUGC hsa-mir-548o Homo sapiens miR-548o stem-loop
hsa-miR-548p UAGCAAAAACUGCAGUUACUUU hsa-mir-548p Homo sapiens miR-548p stem-loop
hsa-miR-548q GCUGGUGCAAAAGUAAUGGCGG hsa-mir-548q Homo sapiens miR-548q stem-loop
hsa-miR-548s AUGGCCAAAACUGCAGUUAUUUU hsa-mir-548s Homo sapiens miR-548s stem-loop
hsa-miR-548t CAAAAGUGAUCGUGGUUUUUG hsa-mir-548t Homo sapiens miR-548t stem-loop
hsa-miR-548u CAAAGACUGCAAUUACUUUUGCG hsa-mir-548u Homo sapiens miR-548u stem-loop
hsa-miR-548v AGCUACAGUUACUUUUGCACCA hsa-mir-548v Homo sapiens miR-548v stem-loop
hsa-miR-548w AAAAGUAACUGCGGUUUUUGCCU hsa-mir-548w Homo sapiens miR-548w stem-loop
hsa-miR-548x UAAAAACUGCAAUUACUUUCA hsa-mir-548x Homo sapiens miR-548x stem-loop
hsa-miR-548y AAAAGUAAUCACUGUUUUUGCC hsa-mir-548y Homo sapiens miR-548y stem-loop
hsa-miR-548z CAAAAACCGCAAUUACUUUUGCA hsa-mir-548z Homo sapiens miR-548z stem-loop
hsa-miR-549 UGACAACUAUGGAUGAGCUCU hsa-mir-549 Homo sapiens miR-549 stem-loop
hsa-miR-550a AGUGCCUGAGGGAGUAAGAGCCC hsa-mir-550a-1 Homo sapiens miR-550a-1 stem-loop
hsa-mir-550a-2 Homo sapiens miR-550a-2 stem-loop
hsa-miR-550a* UGUCUUACUCCCUCAGGCACAU hsa-mir-550a-1 Homo sapiens miR-550a-1 stem-loop
hsa-mir-550a-2 Homo sapiens miR-550a-2 stem-loop
hsa-miR-550b UCUUACUCCCUCAGGCACUG hsa-mir-550b-1 Homo sapiens miR-550b-1 stem-loop
hsa-mir-550b-2 Homo sapiens miR-550b-2 stem-loop
hsa-miR-551a GCGACCCACUCUUGGUUUCCA hsa-mir-551a Homo sapiens miR-551a stem-loop
hsa-miR-551b* GAAAUCAAGCGUGGGUGAGACC hsa-mir-551b Homo sapiens miR-551b stem-loop
hsa-miR-551b GCGACCCAUACUUGGUUUCAG hsa-mir-551b Homo sapiens miR-551b stem-loop
hsa-miR-552 AACAGGUGACUGGUUAGACAA hsa-mir-552 Homo sapiens miR-552 stem-loop
hsa-miR-553 AAAACGGUGAGAUUUUGUUUU hsa-mir-553 Homo sapiens miR-553 stem-loop
hsa-miR-554 GCUAGUCCUGACUCAGCCAGU hsa-mir-554 Homo sapiens miR-554 stem-loop
hsa-miR-555 AGGGUAAGCUGAACCUCUGAU hsa-mir-555 Homo sapiens miR-555 stem-loop
hsa-miR-556-5p GAUGAGCUCAUUGUAAUAUGAG hsa-mir-556 Homo sapiens miR-556 stem-loop
hsa-miR-556-3p AUAUUACCAUUAGCUCAUCUUU hsa-mir-556 Homo sapiens miR-556 stem-loop
hsa-miR-557 GUUUGCACGGGUGGGCCUUGUCU hsa-mir-557 Homo sapiens miR-557 stem-loop
hsa-miR-558 UGAGCUGCUGUACCAAAAU hsa-mir-558 Homo sapiens miR-558 stem-loop
hsa-miR-559 UAAAGUAAAUAUGCACCAAAA hsa-mir-559 Homo sapiens miR-559 stem-loop
hsa-miR-561 CAAAGUUUAAGAUCCUUGAAGU hsa-mir-561 Homo sapiens miR-561 stem-loop
hsa-miR-562 AAAGUAGCUGUACCAUUUGC hsa-mir-562 Homo sapiens miR-562 stem-loop
hsa-miR-563 AGGUUGACAUACGUUUCCC hsa-mir-563 Homo sapiens miR-563 stem-loop
hsa-miR-564 AGGCACGGUGUCAGCAGGC hsa-mir-564 Homo sapiens miR-564 stem-loop
hsa-miR-566 GGGCGCCUGUGAUCCCAAC hsa-mir-566 Homo sapiens miR-566 stem-loop
hsa-miR-567 AGUAUGUUCUUCCAGGACAGAAC hsa-mir-567 Homo sapiens miR-567 stem-loop
hsa-miR-568 AUGUAUAAAUGUAUACACAC hsa-mir-568 Homo sapiens miR-568 stem-loop
hsa-miR-569 AGUUAAUGAAUCCUGGAAAGU hsa-mir-569 Homo sapiens miR-569 stem-loop
hsa-miR-570 CGAAAACAGCAAUUACCUUUGC hsa-mir-570 Homo sapiens miR-570 stem-loop
hsa-miR-571 UGAGUUGGCCAUCUGAGUGAG hsa-mir-571 Homo sapiens miR-571 stem-loop
hsa-miR-572 GUCCGCUCGGCGGUGGCCCA hsa-mir-572 Homo sapiens miR-572 stem-loop
hsa-miR-573 CUGAAGUGAUGUGUAACUGAUCAG hsa-mir-573 Homo sapiens miR-573 stem-loop
hsa-miR-574-5p UGAGUGUGUGUGUGUGAGUGUGU hsa-mir-574 Homo sapiens miR-574 stem-loop
hsa-miR-574-3p CACGCUCAUGCACACACCCACA hsa-mir-574 Homo sapiens miR-574 stem-loop
hsa-miR-575 GAGCCAGUUGGACAGGAGC hsa-mir-575 Homo sapiens miR-575 stem-loop
hsa-miR-576-5p AUUCUAAUUUCUCCACGUCUUU hsa-mir-576 Homo sapiens miR-576 stem-loop
hsa-miR-576-3p AAGAUGUGGAAAAAUUGGAAUC hsa-mir-576 Homo sapiens miR-576 stem-loop
hsa-miR-577 UAGAUAAAAUAUUGGUACCUG hsa-mir-577 Homo sapiens miR-577 stem-loop
hsa-miR-578 CUUCUUGUGCUCUAGGAUUGU hsa-mir-578 Homo sapiens miR-578 stem-loop
hsa-miR-579 UUCAUUUGGUAUAAACCGCGAUU hsa-mir-579 Homo sapiens miR-579 stem-loop
hsa-miR-580 UUGAGAAUGAUGAAUCAUUAGG hsa-mir-580 Homo sapiens miR-580 stem-loop
hsa-miR-581 UCUUGUGUUCUCUAGAUCAGU hsa-mir-581 Homo sapiens miR-581 stem-loop
hsa-miR-582-5p UUACAGUUGUUCAACCAGUUACU hsa-mir-582 Homo sapiens miR-582 stem-loop
hsa-miR-582-3p UAACUGGUUGAACAACUGAACC hsa-mir-582 Homo sapiens miR-582 stem-loop
hsa-miR-583 CAAAGAGGAAGGUCCCAUUAC hsa-mir-583 Homo sapiens miR-583 stem-loop
hsa-miR-584 UUAUGGUUUGCCUGGGACUGAG hsa-mir-584 Homo sapiens miR-584 stem-loop
hsa-miR-585 UGGGCGUAUCUGUAUGCUA hsa-mir-585 Homo sapiens miR-585 stem-loop
hsa-miR-586 UAUGCAUUGUAUUUUUAGGUCC hsa-mir-586 Homo sapiens miR-586 stem-loop
hsa-miR-587 UUUCCAUAGGUGAUGAGUCAC hsa-mir-587 Homo sapiens miR-587 stem-loop
hsa-miR-588 UUGGCCACAAUGGGUUAGAAC hsa-mir-588 Homo sapiens miR-588 stem-loop
hsa-miR-589 UGAGAACCACGUCUGCUCUGAG hsa-mir-589 Homo sapiens miR-589 stem-loop
hsa-miR-589* UCAGAACAAAUGCCGGUUCCCAGA hsa-mir-589 Homo sapiens miR-589 stem-loop
hsa-miR-590-5p GAGCUUAUUCAUAAAAGUGCAG hsa-mir-590 Homo sapiens miR-590 stem-loop
hsa-miR-590-3p UAAUUUUAUGUAUAAGCUAGU hsa-mir-590 Homo sapiens miR-590 stem-loop
hsa-miR-591 AGACCAUGGGUUCUCAUUGU hsa-mir-591 Homo sapiens miR-591 stem-loop
hsa-miR-592 UUGUGUCAAUAUGCGAUGAUGU hsa-mir-592 Homo sapiens miR-592 stem-loop
hsa-miR-593* AGGCACCAGCCAGGCAUUGCUCAGC hsa-mir-593 Homo sapiens miR-593 stem-loop
hsa-miR-593 UGUCUCUGCUGGGGUUUCU hsa-mir-593 Homo sapiens miR-593 stem-loop
hsa-miR-595 GAAGUGUGCCGUGGUGUGUCU hsa-mir-595 Homo sapiens miR-595 stem-loop
hsa-miR-596 AAGCCUGCCCGGCUCCUCGGG hsa-mir-596 Homo sapiens miR-596 stem-loop
hsa-miR-597 UGUGUCACUCGAUGACCACUGU hsa-mir-597 Homo sapiens miR-597 stem-loop
hsa-miR-598 UACGUCAUCGUUGUCAUCGUCA hsa-mir-598 Homo sapiens miR-598 stem-loop
hsa-miR-599 GUUGUGUCAGUUUAUCAAAC hsa-mir-599 Homo sapiens miR-599 stem-loop
hsa-miR-600 ACUUACAGACAAGAGCCUUGCUC hsa-mir-600 Homo sapiens miR-600 stem-loop
hsa-miR-601 UGGUCUAGGAUUGUUGGAGGAG hsa-mir-601 Homo sapiens miR-601 stem-loop
hsa-miR-602 GACACGGGCGACAGCUGCGGCCC hsa-mir-602 Homo sapiens miR-602 stem-loop
hsa-miR-603 CACACACUGCAAUUACUUUUGC hsa-mir-603 Homo sapiens miR-603 stem-loop
hsa-miR-604 AGGCUGCGGAAUUCAGGAC hsa-mir-604 Homo sapiens miR-604 stem-loop
hsa-miR-605 UAAAUCCCAUGGUGCCUUCUCCU hsa-mir-605 Homo sapiens miR-605 stem-loop
hsa-miR-606 AAACUACUGAAAAUCAAAGAU hsa-mir-606 Homo sapiens miR-606 stem-loop
hsa-miR-607 GUUCAAAUCCAGAUCUAUAAC hsa-mir-607 Homo sapiens miR-607 stem-loop
hsa-miR-608 AGGGGUGGUGUUGGGACAGCUCCGU hsa-mir-608 Homo sapiens miR-608 stem-loop
hsa-miR-609 AGGGUGUUUCUCUCAUCUCU hsa-mir-609 Homo sapiens miR-609 stem-loop
hsa-miR-610 UGAGCUAAAUGUGUGCUGGGA hsa-mir-610 Homo sapiens miR-610 stem-loop
hsa-miR-611 GCGAGGACCCCUCGGGGUCUGAC hsa-mir-611 Homo sapiens miR-611 stem-loop
hsa-miR-612 GCUGGGCAGGGCUUCUGAGCUCCUU hsa-mir-612 Homo sapiens miR-612 stem-loop
hsa-miR-613 AGGAAUGUUCCUUCUUUGCC hsa-mir-613 Homo sapiens miR-613 stem-loop
hsa-miR-614 GAACGCCUGUUCUUGCCAGGUGG hsa-mir-614 Homo sapiens miR-614 stem-loop
hsa-miR-615-5p GGGGGUCCCCGGUGCUCGGAUC hsa-mir-615 Homo sapiens miR-615 stem-loop
hsa-miR-615-3p UCCGAGCCUGGGUCUCCCUCUU hsa-mir-615 Homo sapiens miR-615 stem-loop
hsa-miR-616* ACUCAAAACCCUUCAGUGACUU hsa-mir-616 Homo sapiens miR-616 stem-loop
hsa-miR-616 AGUCAUUGGAGGGUUUGAGCAG hsa-mir-616 Homo sapiens miR-616 stem-loop
hsa-miR-617 AGACUUCCCAUUUGAAGGUGGC hsa-mir-617 Homo sapiens miR-617 stem-loop
hsa-miR-618 AAACUCUACUUGUCCUUCUGAGU hsa-mir-618 Homo sapiens miR-618 stem-loop
hsa-miR-619 GACCUGGACAUGUUUGUGCCCAGU hsa-mir-619 Homo sapiens miR-619 stem-loop
hsa-miR-620 AUGGAGAUAGAUAUAGAAAU hsa-mir-620 Homo sapiens miR-620 stem-loop
hsa-miR-621 GGCUAGCAACAGCGCUUACCU hsa-mir-621 Homo sapiens miR-621 stem-loop
hsa-miR-622 ACAGUCUGCUGAGGUUGGAGC hsa-mir-622 Homo sapiens miR-622 stem-loop
hsa-miR-623 AUCCCUUGCAGGGGCUGUUGGGU hsa-mir-623 Homo sapiens miR-623 stem-loop
hsa-miR-624* UAGUACCAGUACCUUGUGUUCA hsa-mir-624 Homo sapiens miR-624 stem-loop
hsa-miR-624 CACAAGGUAUUGGUAUUACCU hsa-mir-624 Homo sapiens miR-624 stem-loop
hsa-miR-625 AGGGGGAAAGUUCUAUAGUCC hsa-mir-625 Homo sapiens miR-625 stem-loop
hsa-miR-625* GACUAUAGAACUUUCCCCCUCA hsa-mir-625 Homo sapiens miR-625 stem-loop
hsa-miR-626 AGCUGUCUGAAAAUGUCUU hsa-mir-626 Homo sapiens miR-626 stem-loop
hsa-miR-627 GUGAGUCUCUAAGAAAAGAGGA hsa-mir-627 Homo sapiens miR-627 stem-loop
hsa-miR-628-5p AUGCUGACAUAUUUACUAGAGG hsa-mir-628 Homo sapiens miR-628 stem-loop
hsa-miR-628-3p UCUAGUAAGAGUGGCAGUCGA hsa-mir-628 Homo sapiens miR-628 stem-loop
hsa-miR-629 UGGGUUUACGUUGGGAGAACU hsa-mir-629 Homo sapiens miR-629 stem-loop
hsa-miR-629* GUUCUCCCAACGUAAGCCCAGC hsa-mir-629 Homo sapiens miR-629 stem-loop
hsa-miR-630 AGUAUUCUGUACCAGGGAAGGU hsa-mir-630 Homo sapiens miR-630 stem-loop
hsa-miR-631 AGACCUGGCCCAGACCUCAGC hsa-mir-631 Homo sapiens miR-631 stem-loop
hsa-miR-632 GUGUCUGCUUCCUGUGGGA hsa-mir-632 Homo sapiens miR-632 stem-loop
hsa-miR-633 CUAAUAGUAUCUACCACAAUAAA hsa-mir-633 Homo sapiens miR-633 stem-loop
hsa-miR-634 AACCAGCACCCCAACUUUGGAC hsa-mir-634 Homo sapiens miR-634 stem-loop
hsa-miR-635 ACUUGGGCACUGAAACAAUGUCC hsa-mir-635 Homo sapiens miR-635 stem-loop
hsa-miR-636 UGUGCUUGCUCGUCCCGCCCGCA hsa-mir-636 Homo sapiens miR-636 stem-loop
hsa-miR-637 ACUGGGGGCUUUCGGGCUCUGCGU hsa-mir-637 Homo sapiens miR-637 stem-loop
hsa-miR-638 AGGGAUCGCGGGCGGGUGGCGGCCU hsa-mir-638 Homo sapiens miR-638 stem-loop
hsa-miR-639 AUCGCUGCGGUUGCGAGCGCUGU hsa-mir-639 Homo sapiens miR-639 stem-loop
hsa-miR-640 AUGAUCCAGGAACCUGCCUCU hsa-mir-640 Homo sapiens miR-640 stem-loop
hsa-miR-641 AAAGACAUAGGAUAGAGUCACCUC hsa-mir-641 Homo sapiens miR-641 stem-loop
hsa-miR-642a GUCCCUCUCCAAAUGUGUCUUG hsa-mir-642a Homo sapiens miR-642a stem-loop
hsa-miR-642b AGACACAUUUGGAGAGGGACCC hsa-mir-642b Homo sapiens miR-642b stem-loop
hsa-miR-643 ACUUGUAUGCUAGCUCAGGUAG hsa-mir-643 Homo sapiens miR-643 stem-loop
hsa-miR-644 AGUGUGGCUUUCUUAGAGC hsa-mir-644 Homo sapiens miR-644 stem-loop
hsa-miR-645 UCUAGGCUGGUACUGCUGA hsa-mir-645 Homo sapiens miR-645 stem-loop
hsa-miR-646 AAGCAGCUGCCUCUGAGGC hsa-mir-646 Homo sapiens miR-646 stem-loop
hsa-miR-647 GUGGCUGCACUCACUUCCUUC hsa-mir-647 Homo sapiens miR-647 stem-loop
hsa-miR-648 AAGUGUGCAGGGCACUGGU hsa-mir-648 Homo sapiens miR-648 stem-loop
hsa-miR-649 AAACCUGUGUUGUUCAAGAGUC hsa-mir-649 Homo sapiens miR-649 stem-loop
hsa-miR-650 AGGAGGCAGCGCUCUCAGGAC hsa-mir-650 Homo sapiens miR-650 stem-loop
hsa-miR-651 UUUAGGAUAAGCUUGACUUUUG hsa-mir-651 Homo sapiens miR-651 stem-loop
hsa-miR-652 AAUGGCGCCACUAGGGUUGUG hsa-mir-652 Homo sapiens miR-652 stem-loop
hsa-miR-653 GUGUUGAAACAAUCUCUACUG hsa-mir-653 Homo sapiens miR-653 stem-loop
hsa-miR-654-5p UGGUGGGCCGCAGAACAUGUGC hsa-mir-654 Homo sapiens miR-654 stem-loop
hsa-miR-654-3p UAUGUCUGCUGACCAUCACCUU hsa-mir-654 Homo sapiens miR-654 stem-loop
hsa-miR-655 AUAAUACAUGGUUAACCUCUUU hsa-mir-655 Homo sapiens miR-655 stem-loop
hsa-miR-656 AAUAUUAUACAGUCAACCUCU hsa-mir-656 Homo sapiens miR-656 stem-loop
hsa-miR-657 GGCAGGUUCUCACCCUCUCUAGG hsa-mir-657 Homo sapiens miR-657 stem-loop
hsa-miR-658 GGCGGAGGGAAGUAGGUCCGUUGGU hsa-mir-658 Homo sapiens miR-658 stem-loop
hsa-miR-659 CUUGGUUCAGGGAGGGUCCCCA hsa-mir-659 Homo sapiens miR-659 stem-loop
hsa-miR-660 UACCCAUUGCAUAUCGGAGUUG hsa-mir-660 Homo sapiens miR-660 stem-loop
hsa-miR-661 UGCCUGGGUCUCUGGCCUGCGCGU hsa-mir-661 Homo sapiens miR-661 stem-loop
hsa-miR-662 UCCCACGUUGUGGCCCAGCAG hsa-mir-662 Homo sapiens miR-662 stem-loop
hsa-miR-663 AGGCGGGGCGCCGCGGGACCGC hsa-mir-663 Homo sapiens miR-663 stem-loop
hsa-miR-663b GGUGGCCCGGCCGUGCCUGAGG hsa-mir-663b Homo sapiens miR-663b stem-loop
hsa-miR-664* ACUGGCUAGGGAAAAUGAUUGGAU hsa-mir-664 Homo sapiens miR-664 stem-loop
hsa-miR-664 UAUUCAUUUAUCCCCAGCCUACA hsa-mir-664 Homo sapiens miR-664 stem-loop
hsa-miR-665 ACCAGGAGGCUGAGGCCCCU hsa-mir-665 Homo sapiens miR-665 stem-loop
hsa-miR-668 UGUCACUCGGCUCGGCCCACUAC hsa-mir-668 Homo sapiens miR-668 stem-loop
hsa-miR-670 GUCCCUGAGUGUAUGUGGUG hsa-mir-670 Homo sapiens mir-670 stem-loop
hsa-miR-671-5p AGGAAGCCCUGGAGGGGCUGGAG hsa-mir-671 Homo sapiens miR-671 stem-loop
hsa-miR-671-3p UCCGGUUCUCAGGGCUCCACC hsa-mir-671 Homo sapiens miR-671 stem-loop
hsa-miR-675 UGGUGCGGAGAGGGCCCACAGUG hsa-mir-675 Homo sapiens miR-675 stem-loop
hsa-miR-675* CUGUAUGCCCUCACCGCUCA hsa-mir-675 Homo sapiens miR-675 stem-loop
hsa-miR-676* UCUUCAACCUCAGGACUUGCA hsa-mir-676 Homo sapiens miR-676 stem-loop
hsa-miR-676 CUGUCCUAAGGUUGUUGAGUU hsa-mir-676 Homo sapiens miR-676 stem-loop
hsa-miR-7 UGGAAGACUAGUGAUUUUGUUGU hsa-mir-7-1 Homo sapiens miR-7-1 stem-loop
hsa-mir-7-2 Homo sapiens miR-7-2 stem-loop
hsa-mir-7-3 Homo sapiens miR-7-3 stem-loop
hsa-miR-7-1* CAACAAAUCACAGUCUGCCAUA hsa-mir-7-1 Homo sapiens miR-7-1 stem-loop
hsa-miR-7-2* CAACAAAUCCCAGUCUACCUAA hsa-mir-7-2 Homo sapiens miR-7-2 stem-loop
hsa-miR-708 AAGGAGCUUACAAUCUAGCUGGG hsa-mir-708 Homo sapiens miR-708 stem-loop
hsa-miR-708* CAACUAGACUGUGAGCUUCUAG hsa-mir-708 Homo sapiens miR-708 stem-loop
hsa-miR-711 GGGACCCAGGGAGAGACGUAAG hsa-mir-711 Homo sapiens miR-711 stem-loop
hsa-miR-718 CUUCCGCCCCGCCGGGCGUCG hsa-mir-718 Homo sapiens miR-718 stem-loop
hsa-miR-720 UCUCGCUGGGGCCUCCA hsa-mir-720 Homo sapiens miR-720 stem-loop
hsa-miR-744 UGCGGGGCUAGGGCUAACAGCA hsa-mir-744 Homo sapiens miR-744 stem-loop
hsa-miR-744* CUGUUGCCACUAACCUCAACCU hsa-mir-744 Homo sapiens miR-744 stem-loop
hsa-miR-758 UUUGUGACCUGGUCCACUAACC hsa-mir-758 Homo sapiens miR-758 stem-loop
hsa-miR-759 GCAGAGUGCAAACAAUUUUGAC hsa-mir-759 Homo sapiens mir-759 stem-loop
hsa-miR-760 CGGCUCUGGGUCUGUGGGGA hsa-mir-760 Homo sapiens miR-760 stem-loop
hsa-miR-761 GCAGCAGGGUGAAACUGACACA hsa-mir-761 Homo sapiens mir-761 stem-loop
hsa-miR-762 GGGGCUGGGGCCGGGGCCGAGC hsa-mir-762 Homo sapiens mir-762 stem-loop
hsa-miR-764 GCAGGUGCUCACUUGUCCUCCU hsa-mir-764 Homo sapiens mir-764 stem-loop
hsa-miR-765 UGGAGGAGAAGGAAGGUGAUG hsa-mir-765 Homo sapiens miR-765 stem-loop
hsa-miR-766 ACUCCAGCCCCACAGCCUCAGC hsa-mir-766 Homo sapiens miR-766 stem-loop
hsa-miR-767-5p UGCACCAUGGUUGUCUGAGCAUG hsa-mir-767 Homo sapiens miR-767 stem-loop
hsa-miR-767-3p UCUGCUCAUACCCCAUGGUUUCU hsa-mir-767 Homo sapiens miR-767 stem-loop
hsa-miR-769-5p UGAGACCUCUGGGUUCUGAGCU hsa-mir-769 Homo sapiens miR-769 stem-loop
hsa-miR-769-3p CUGGGAUCUCCGGGGUCUUGGUU hsa-mir-769 Homo sapiens miR-769 stem-loop
hsa-miR-770-5p UCCAGUACCACGUGUCAGGGCCA hsa-mir-770 Homo sapiens miR-770 stem-loop
hsa-miR-802 CAGUAACAAAGAUUCAUCCUUGU hsa-mir-802 Homo sapiens mir-802 stem-loop
hsa-miR-873 GCAGGAACUUGUGAGUCUCCU hsa-mir-873 Homo sapiens miR-873 stem-loop
hsa-miR-874 CUGCCCUGGCCCGAGGGACCGA hsa-mir-874 Homo sapiens miR-874 stem-loop
hsa-miR-875-5p UAUACCUCAGUUUUAUCAGGUG hsa-mir-875 Homo sapiens miR-875 stem-loop
hsa-miR-875-3p CCUGGAAACACUGAGGUUGUG hsa-mir-875 Homo sapiens miR-875 stem-loop
hsa-miR-876-5p UGGAUUUCUUUGUGAAUCACCA hsa-mir-876 Homo sapiens miR-876 stem-loop
hsa-miR-876-3p UGGUGGUUUACAAAGUAAUUCA hsa-mir-876 Homo sapiens miR-876 stem-loop
hsa-miR-877 GUAGAGGAGAUGGCGCAGGG hsa-mir-877 Homo sapiens miR-877 stem-loop
hsa-miR-877* UCCUCUUCUCCCUCCUCCCAG hsa-mir-877 Homo sapiens miR-877 stem-loop
hsa-miR-885-5p UCCAUUACACUACCCUGCCUCU hsa-mir-885 Homo sapiens miR-885 stem-loop
hsa-miR-885-3p AGGCAGCGGGGUGUAGUGGAUA hsa-mir-885 Homo sapiens miR-885 stem-loop
hsa-miR-887 GUGAACGGGCGCCAUCCCGAGG hsa-mir-887 Homo sapiens miR-887 stem-loop
hsa-miR-888 UACUCAAAAAGCUGUCAGUCA hsa-mir-888 Homo sapiens miR-888 stem-loop
hsa-miR-888* GACUGACACCUCUUUGGGUGAA hsa-mir-888 Homo sapiens miR-888 stem-loop
hsa-miR-889 UUAAUAUCGGACAACCAUUGU hsa-mir-889 Homo sapiens miR-889 stem-loop
hsa-miR-890 UACUUGGAAAGGCAUCAGUUG hsa-mir-890 Homo sapiens miR-890 stem-loop
hsa-miR-891a UGCAACGAACCUGAGCCACUGA hsa-mir-891a Homo sapiens miR-891a stem-loop
hsa-miR-891b UGCAACUUACCUGAGUCAUUGA hsa-mir-891b Homo sapiens miR-891b stem-loop
hsa-miR-892a CACUGUGUCCUUUCUGCGUAG hsa-mir-892a Homo sapiens miR-892a stem-loop
hsa-miR-892b CACUGGCUCCUUUCUGGGUAGA hsa-mir-892b Homo sapiens miR-892b stem-loop
hsa-miR-9 UCUUUGGUUAUCUAGCUGUAUGA hsa-mir-9-1 Homo sapiens miR-9-1 stem-loop
hsa-mir-9-2 Homo sapiens miR-9-2 stem-loop
hsa-mir-9-3 Homo sapiens miR-9-3 stem-loop
hsa-miR-9* AUAAAGCUAGAUAACCGAAAGU hsa-mir-9-1 Homo sapiens miR-9-1 stem-loop
hsa-mir-9-2 Homo sapiens miR-9-2 stem-loop
hsa-mir-9-3 Homo sapiens miR-9-3 stem-loop
hsa-miR-920 GGGGAGCUGUGGAAGCAGUA hsa-mir-920 Homo sapiens miR-920 stem-loop
hsa-miR-921 CUAGUGAGGGACAGAACCAGGAUUC hsa-mir-921 Homo sapiens miR-921 stem-loop
hsa-miR-922 GCAGCAGAGAAUAGGACUACGUC hsa-mir-922 Homo sapiens miR-922 stem-loop
hsa-miR-924 AGAGUCUUGUGAUGUCUUGC hsa-mir-924 Homo sapiens miR-924 stem-loop
hsa-miR-92a-1* AGGUUGGGAUCGGUUGCAAUGCU hsa-mir-92a-1 Homo sapiens miR-92a-1 stem-loop
hsa-miR-92a UAUUGCACUUGUCCCGGCCUGU hsa-mir-92a-1 Homo sapiens miR-92a-1 stem-loop
hsa-mir-92a-2 Homo sapiens miR-92a-2 stem-loop
hsa-miR-92a-2* GGGUGGGGAUUUGUUGCAUUAC hsa-mir-92a-2 Homo sapiens miR-92a-2 stem-loop
hsa-miR-92b* AGGGACGGGACGCGGUGCAGUG hsa-mir-92b Homo sapiens miR-92b stem-loop
hsa-miR-92b UAUUGCACUCGUCCCGGCCUCC hsa-mir-92b Homo sapiens miR-92b stem-loop
hsa-miR-93 CAAAGUGCUGUUCGUGCAGGUAG hsa-mir-93 Homo sapiens miR-93 stem-loop
hsa-miR-93* ACUGCUGAGCUAGCACUUCCCG hsa-mir-93 Homo sapiens miR-93 stem-loop
hsa-miR-933 UGUGCGCAGGGAGACCUCUCCC hsa-mir-933 Homo sapiens miR-933 stem-loop
hsa-miR-934 UGUCUACUACUGGAGACACUGG hsa-mir-934 Homo sapiens miR-934 stem-loop
hsa-miR-935 CCAGUUACCGCUUCCGCUACCGC hsa-mir-935 Homo sapiens miR-935 stem-loop
hsa-miR-936 ACAGUAGAGGGAGGAAUCGCAG hsa-mir-936 Homo sapiens miR-936 stem-loop
hsa-miR-937 AUCCGCGCUCUGACUCUCUGCC hsa-mir-937 Homo sapiens miR-937 stem-loop
hsa-miR-938 UGCCCUUAAAGGUGAACCCAGU hsa-mir-938 Homo sapiens miR-938 stem-loop
hsa-miR-939 UGGGGAGCUGAGGCUCUGGGGGUG hsa-mir-939 Homo sapiens miR-939 stem-loop
hsa-miR-940 AAGGCAGGGCCCCCGCUCCCC hsa-mir-940 Homo sapiens miR-940 stem-loop
hsa-miR-941 CACCCGGCUGUGUGCACAUGUGC hsa-mir-941-1 Homo sapiens miR-941-1 stem-loop
hsa-mir-941-2 Homo sapiens miR-941-2 stem-loop
hsa-mir-941-3 Homo sapiens miR-941-3 stem-loop
hsa-mir-941-4 Homo sapiens miR-941-4 stem-loop
hsa-miR-942 UCUUCUCUGUUUUGGCCAUGUG hsa-mir-942 Homo sapiens miR-942 stem-loop
hsa-miR-943 CUGACUGUUGCCGUCCUCCAG hsa-mir-943 Homo sapiens miR-943 stem-loop
hsa-miR-944 AAAUUAUUGUACAUCGGAUGAG hsa-mir-944 Homo sapiens miR-944 stem-loop
hsa-miR-95 UUCAACGGGUAUUUAUUGAGCA hsa-mir-95 Homo sapiens miR-95 stem-loop
hsa-miR-96 UUUGGCACUAGCACAUUUUUGCU hsa-mir-96 Homo sapiens miR-96 stem-loop
hsa-miR-96* AAUCAUGUGCAGUGCCAAUAUG hsa-mir-96 Homo sapiens miR-96 stem-loop
hsa-miR-98 UGAGGUAGUAAGUUGUAUUGUU hsa-mir-98 Homo sapiens miR-98 stem-loop
hsa-miR-99a AACCCGUAGAUCCGAUCUUGUG hsa-mir-99a Homo sapiens miR-99a stem-loop
hsa-miR-99a* CAAGCUCGCUUCUAUGGGUCUG hsa-mir-99a Homo sapiens miR-99a stem-loop
hsa-miR-99b CACCCGUAGAACCGACCUUGCG hsa-mir-99b Homo sapiens miR-99b stem-loop
hsa-miR-99b* CAAGCUCGUGUCUGUGGGUCCG hsa-mir-99b Homo sapiens miR-99b stem-loop
mmu-let-7a UGAGGUAGUAGGUUGUAUAGUU mmu-let-7a-1 Mus musculus let-7a-1 stem-loop
mmu-let-7a-2 Mus musculus let-7a-2 stem-loop
mmu-let-7a-1* CUAUACAAUCUACUGUCUUUCC mmu-let-7a-1 Mus musculus let-7a-1 stem-loop
mmu-let-7a-2* CUGUACAGCCUCCUAGCUUUC mmu-let-7a-2 Mus musculus let-7a-2 stem-loop
mmu-let-7b UGAGGUAGUAGGUUGUGUGGUU mmu-let-7b Mus musculus let-7b stem-loop
mmu-let-7b* CUAUACAACCUACUGCCUUCCC mmu-let-7b Mus musculus let-7b stem-loop
mmu-let-7c UGAGGUAGUAGGUUGUAUGGUU mmu-let-7c-1 Mus musculus let-7c-1 stem-loop
mmu-let-7c-2 Mus musculus let-7c-2 stem-loop
mmu-let-7c-1* CUGUACAACCUUCUAGCUUUCC mmu-let-7c-1 Mus musculus let-7c-1 stem-loop
mmu-let-7c-2* CUAUACAAUCUACUGUCUUUCC mmu-let-7c-2 Mus musculus let-7c-2 stem-loop
mmu-let-7d AGAGGUAGUAGGUUGCAUAGUU mmu-let-7d Mus musculus let-7d stem-loop
mmu-let-7d* CUAUACGACCUGCUGCCUUUCU mmu-let-7d Mus musculus let-7d stem-loop
mmu-let-7e UGAGGUAGGAGGUUGUAUAGUU mmu-let-7e Mus musculus let-7e stem-loop
mmu-let-7e* CUAUACGGCCUCCUAGCUUUCC mmu-let-7e Mus musculus let-7e stem-loop
mmu-let-7f UGAGGUAGUAGAUUGUAUAGUU mmu-let-7f-1 Mus musculus let-7f-1 stem-loop
mmu-let-7f-2 Mus musculus let-7f-2 stem-loop
mmu-let-7f-1* CUAUACAAUCUAUUGCCUUCCC mmu-let-7f-1 Mus musculus let-7f-1 stem-loop
mmu-let-7f-2* CUAUACAGUCUACUGUCUUUC mmu-let-7f-2 Mus musculus let-7f-2 stem-loop
mmu-let-7g UGAGGUAGUAGUUUGUACAGUU mmu-let-7g Mus musculus let-7g stem-loop
mmu-let-7g* ACUGUACAGGCCACUGCCUUGC mmu-let-7g Mus musculus let-7g stem-loop
mmu-let-7i UGAGGUAGUAGUUUGUGCUGUU mmu-let-7i Mus musculus let-7i stem-loop
mmu-let-7i* CUGCGCAAGCUACUGCCUUGCU mmu-let-7i Mus musculus let-7i stem-loop
mmu-miR-1-1* ACAUACUUCUUUAUAUGCCCAUA mmu-mir-1-1 Mus musculus miR-1-1 stem-loop
mmu-miR-1 UGGAAUGUAAAGAAGUAUGUAU mmu-mir-1-1 Mus musculus miR-1-1 stem-loop
mmu-mir-1-2 Mus musculus miR-1-2 stem-loop
mmu-miR-1-2* ACAUACUUCUUUAUGUACCCAUA mmu-mir-1-2 Mus musculus miR-1-2 stem-loop
mmu-miR-1-2-as-5p UACAUACUUCUUUACAUUCCA mmu-mir-1-2-as Mus musculus miR-1-2-as stem-loop
mmu-miR-1-2-as-3p UGGGUACAUAAAGAAGUAUGUGC mmu-mir-1-2-as Mus musculus miR-1-2-as stem-loop
mmu-miR-100 AACCCGUAGAUCCGAACUUGUG mmu-mir-100 Mus musculus miR-100 stem-loop
mmu-miR-100* ACAAGCUUGUGUCUAUAGGUAU mmu-mir-100 Mus musculus miR-100 stem-loop
mmu-miR-101a* UCAGUUAUCACAGUGCUGAUGC mmu-mir-101a Mus musculus miR-101a stem-loop
mmu-miR-101a UACAGUACUGUGAUAACUGAA mmu-mir-101a Mus musculus miR-101a stem-loop
mmu-miR-101b* UCGGUUAUCAUGGUACCGAUGCU mmu-mir-101b Mus musculus miR-101b stem-loop
mmu-miR-101b UACAGUACUGUGAUAGCUGAA mmu-mir-101b Mus musculus miR-101b stem-loop
mmu-miR-103-1* GGCUUCUUUACAGUGCUGCCUUG mmu-mir-103-1 Mus musculus miR-103-1 stem-loop
mmu-miR-103 AGCAGCAUUGUACAGGGCUAUGA mmu-mir-103-1 Mus musculus miR-103-1 stem-loop
mmu-mir-103-2 Mus musculus miR-103-2 stem-loop
mmu-miR-103-2* AGCUUCUUUACAGUGCUGCCUUG mmu-mir-103-2 Mus musculus miR-103-2 stem-loop
mmu-miR-105 CCAAGUGCUCAGAUGCUUGUGGU mmu-mir-105 Mus musculus miR-105 stem-loop
mmu-miR-106a CAAAGUGCUAACAGUGCAGGUAG mmu-mir-106a Mus musculus miR-106a stem-loop
mmu-miR-106a* ACUGCAGUGCCAGCACUUCUUAC mmu-mir-106a Mus musculus miR-106a stem-loop
mmu-miR-106b UAAAGUGCUGACAGUGCAGAU mmu-mir-106b Mus musculus miR-106b stem-loop
mmu-miR-106b* CCGCACUGUGGGUACUUGCUGC mmu-mir-106b Mus musculus miR-106b stem-loop
mmu-miR-107* AGCUUCUUUACAGUGUUGCCUUG mmu-mir-107 Mus musculus miR-107 stem-loop
mmu-miR-107 AGCAGCAUUGUACAGGGCUAUCA mmu-mir-107 Mus musculus miR-107 stem-loop
mmu-miR-10a UACCCUGUAGAUCCGAAUUUGUG mmu-mir-10a Mus musculus miR-10a stem-loop
mmu-miR-10a* CAAAUUCGUAUCUAGGGGAAUA mmu-mir-10a Mus musculus miR-10a stem-loop
mmu-miR-10b UACCCUGUAGAACCGAAUUUGUG mmu-mir-10b Mus musculus miR-10b stem-loop
mmu-miR-10b* CAGAUUCGAUUCUAGGGGAAUA mmu-mir-10b Mus musculus miR-10b stem-loop
mmu-miR-1186 GAGUGCUGGAAUUAAAGGCAUG mmu-mir-1186 Mus musculus miR-1186 stem-loop
mmu-miR-1186b UGGGAUUAAAGGCAUGCACCAC mmu-mir-1186b Mus musculus miR-1186b stem-loop
mmu-miR-1187 UAUGUGUGUGUGUAUGUGUGUAA mmu-mir-1187 Mus musculus miR-1187 stem-loop
mmu-miR-1188 UGGUGUGAGGUUGGGCCAGGA mmu-mir-1188 Mus musculus miR-1188 stem-loop
mmu-miR-1188* UCCGAGGCUCCCCACCACACCCUGC mmu-mir-1188 Mus musculus miR-1188 stem-loop
mmu-miR-1190 UCAGCUGAGGUUCCCCUCUGUC mmu-mir-1190 Mus musculus miR-1190 stem-loop
mmu-miR-1191 CAGUCUUACUAUGUAGCCCUA mmu-mir-1191 Mus musculus miR-1191 stem-loop
mmu-miR-1192 AAACAAACAAACAGACCAAAUU mmu-mir-1192 Mus musculus miR-1192 stem-loop
mmu-miR-1193-5p UGGUAGACCGGUGACGUACA mmu-mir-1193 Mus musculus miR-1193 stem-loop
mmu-miR-1193-3p UAGGUCACCCGUUUUACUAUC mmu-mir-1193 Mus musculus miR-1193 stem-loop
mmu-miR-1194 GAAUGAGUAACUGCUAGAUCCU mmu-mir-1194 Mus musculus miR-1194 stem-loop
mmu-miR-1195 UGAGUUCGAGGCCAGCCUGCUCA mmu-mir-1195 Mus musculus miR-1195 stem-loop
mmu-miR-1196 AAAUCUACCUGCCUCUGCCU mmu-mir-1196 Mus musculus miR-1196 stem-loop
mmu-miR-1197* CGGUUGACCAUGGUGUGUACG mmu-mir-1197 Mus musculus miR-1197 stem-loop
mmu-miR-1197 UAGGACACAUGGUCUACUUCU mmu-mir-1197 Mus musculus miR-1197 stem-loop
mmu-miR-1198-5p UAUGUGUUCCUGGCUGGCUUGG mmu-mir-1198 Mus musculus miR-1198 stem-loop
mmu-miR-1198-3p AAGCUAGCCUCUAACUCAUGGC mmu-mir-1198 Mus musculus miR-1198 stem-loop
mmu-miR-1199 UCUGAGUCCCGGUCGCGCGG mmu-mir-1199 Mus musculus miR-1199 stem-loop
mmu-miR-1199* UGCGGCCGGUGCUCAGUCGGC mmu-mir-1199 Mus musculus miR-1199 stem-loop
mmu-miR-122 UGGAGUGUGACAAUGGUGUUUG mmu-mir-122 Mus musculus miR-122 stem-loop
mmu-miR-122* AAACGCCAUUAUCACACUAA mmu-mir-122 Mus musculus miR-122 stem-loop
mmu-miR-1224 GUGAGGACUGGGGAGGUGGAG mmu-mir-1224 Mus musculus mir-1224 stem-loop
mmu-miR-1224* CCCCACCUCUUCUCUCCUCAG mmu-mir-1224 Mus musculus mir-1224 stem-loop
mmu-miR-124* CGUGUUCACAGCGGACCUUGAU mmu-mir-124-1 Mus musculus miR-124-1 stem-loop
mmu-mir-124-2 Mus musculus miR-124-2 stem-loop
mmu-mir-124-3 Mus musculus miR-124-3 stem-loop
mmu-miR-124 UAAGGCACGCGGUGAAUGCC mmu-mir-124-1 Mus musculus miR-124-1 stem-loop
mmu-mir-124-2 Mus musculus miR-124-2 stem-loop
mmu-mir-124-3 Mus musculus miR-124-3 stem-loop
mmu-miR-1247 ACCCGUCCCGUUCGUCCCCGGA mmu-mir-1247 Mus musculus miR-1247 stem-loop
mmu-miR-1247* CGGGAACGUCGAGACUGGAGC mmu-mir-1247 Mus musculus miR-1247 stem-loop
mmu-miR-1249* AGGAGGGAGGGGAUGGGCCAAGUUC mmu-mir-1249 Mus musculus mir-1249 stem-loop
mmu-miR-1249 ACGCCCUUCCCCCCCUUCUUCA mmu-mir-1249 Mus musculus mir-1249 stem-loop
mmu-miR-1251 ACUCUAGCUGCCAAAGGCGCU mmu-mir-1251 Mus musculus miR-1251 stem-loop
mmu-miR-1251* CGCUUUGCUCAGCCAGUGUAG mmu-mir-1251 Mus musculus miR-1251 stem-loop
mmu-miR-125a-5p UCCCUGAGACCCUUUAACCUGUGA mmu-mir-125a Mus musculus miR-125a stem-loop
mmu-miR-125a-3p ACAGGUGAGGUUCUUGGGAGCC mmu-mir-125a Mus musculus miR-125a stem-loop
mmu-miR-125b-5p UCCCUGAGACCCUAACUUGUGA mmu-mir-125b-1 Mus musculus miR-125b-1 stem-loop
mmu-mir-125b-2 Mus musculus miR-125b-2 stem-loop
mmu-miR-125b-1-3p ACGGGUUAGGCUCUUGGGAGCU mmu-mir-125b-1 Mus musculus miR-125b-1 stem-loop
mmu-miR-125b-2-3p ACAAGUCAGGUUCUUGGGACCU mmu-mir-125b-2 Mus musculus miR-125b-2 stem-loop
mmu-miR-126-5p CAUUAUUACUUUUGGUACGCG mmu-mir-126 Mus musculus miR-126 stem-loop
mmu-miR-126-3p UCGUACCGUGAGUAAUAAUGCG mmu-mir-126 Mus musculus miR-126 stem-loop
mmu-miR-1264-5p AGGUCCUCAAUAAGUAUUUGUU mmu-mir-1264 Mus musculus miR-1264 stem-loop
mmu-miR-1264-3p CAAAUCUUAUUUGAGCACCUGU mmu-mir-1264 Mus musculus miR-1264 stem-loop
mmu-miR-127* CUGAAGCUCAGAGGGCUCUGAU mmu-mir-127 Mus musculus miR-127 stem-loop
mmu-miR-127 UCGGAUCCGUCUGAGCUUGGCU mmu-mir-127 Mus musculus miR-127 stem-loop
mmu-miR-1274a UCAGGUCCCUGUUCAGGCGCCA mmu-mir-1274a Mus musculus miR-1274a stem-loop
mmu-miR-128-1* CGGGGCCGUAGCACUGUCUGA mmu-mir-128-1 Mus musculus miR-128-1 stem-loop
mmu-miR-128 UCACAGUGAACCGGUCUCUUU mmu-mir-128-1 Mus musculus miR-128-1 stem-loop
mmu-mir-128-2 Mus musculus miR-128-2 stem-loop
mmu-miR-128-2* GGGGGCCGAUGCACUGUAAGAGA mmu-mir-128-2 Mus musculus miR-128-2 stem-loop
mmu-miR-129-5p CUUUUUGCGGUCUGGGCUUGC mmu-mir-129-1 Mus musculus miR-129-1 stem-loop
mmu-mir-129-2 Mus musculus miR-129-2 stem-loop
mmu-miR-129-1-3p AAGCCCUUACCCCAAAAAGUAU mmu-mir-129-1 Mus musculus miR-129-1 stem-loop
mmu-miR-129-2-3p AAGCCCUUACCCCAAAAAGCAU mmu-mir-129-2 Mus musculus miR-129-2 stem-loop
mmu-miR-1298 UUCAUUCGGCUGUCCAGAUGUA mmu-mir-1298 Mus musculus miR-1298 stem-loop
mmu-miR-1298* CAUCUGGGCAACUGAUUGAACU mmu-mir-1298 Mus musculus miR-1298 stem-loop
mmu-miR-1306 ACGUUGGCUCUGGUGGUGAUG mmu-mir-1306 Mus musculus miR-1306 stem-loop
mmu-miR-130a* GCUCUUUUCACAUUGUGCUACU mmu-mir-130a Mus musculus miR-130a stem-loop
mmu-miR-130a CAGUGCAAUGUUAAAAGGGCAU mmu-mir-130a Mus musculus miR-130a stem-loop
mmu-miR-130b* ACUCUUUCCCUGUUGCACUACU mmu-mir-130b Mus musculus miR-130b stem-loop
mmu-miR-130b CAGUGCAAUGAUGAAAGGGCAU mmu-mir-130b Mus musculus miR-130b stem-loop
mmu-miR-132* AACCGUGGCUUUCGAUUGUUAC mmu-mir-132 Mus musculus miR-132 stem-loop
mmu-miR-132 UAACAGUCUACAGCCAUGGUCG mmu-mir-132 Mus musculus miR-132 stem-loop
mmu-miR-133a* GCUGGUAAAAUGGAACCAAAU mmu-mir-133a-1 Mus musculus miR-133a-1 stem-loop
mmu-mir-133a-2 Mus musculus miR-133a-2 stem-loop
mmu-miR-133a UUUGGUCCCCUUCAACCAGCUG mmu-mir-133a-1 Mus musculus miR-133a-1 stem-loop
mmu-mir-133a-2 Mus musculus miR-133a-2 stem-loop
mmu-miR-133b* GCUGGUCAAACGGAACCAAGUC mmu-mir-133b Mus musculus miR-133b stem-loop
mmu-miR-133b UUUGGUCCCCUUCAACCAGCUA mmu-mir-133b Mus musculus miR-133b stem-loop
mmu-miR-134 UGUGACUGGUUGACCAGAGGGG mmu-mir-134 Mus musculus miR-134 stem-loop
mmu-miR-134* CUGUGGGCCACCUAGUCACC mmu-mir-134 Mus musculus miR-134 stem-loop
mmu-miR-135a UAUGGCUUUUUAUUCCUAUGUGA mmu-mir-135a-1 Mus musculus miR-135a-1 stem-loop
mmu-mir-135a-2 Mus musculus miR-135a-2 stem-loop
mmu-miR-135a-1* UAUAGGGAUUGGAGCCGUGGCG mmu-mir-135a-1 Mus musculus miR-135a-1 stem-loop
mmu-miR-135a-2* UGUAGGGAUGGAAGCCAUGAA mmu-mir-135a-2 Mus musculus miR-135a-2 stem-loop
mmu-miR-135b UAUGGCUUUUCAUUCCUAUGUGA mmu-mir-135b Mus musculus miR-135b stem-loop
mmu-miR-135b* AUGUAGGGCUAAAAGCCAUGGG mmu-mir-135b Mus musculus miR-135b stem-loop
mmu-miR-136 ACUCCAUUUGUUUUGAUGAUGG mmu-mir-136 Mus musculus miR-136 stem-loop
mmu-miR-136* AUCAUCGUCUCAAAUGAGUCUU mmu-mir-136 Mus musculus miR-136 stem-loop
mmu-miR-137* ACGGGUAUUCUUGGGUGGAUAAU mmu-mir-137 Mus musculus miR-137 stem-loop
mmu-miR-137 UUAUUGCUUAAGAAUACGCGUAG mmu-mir-137 Mus musculus miR-137 stem-loop
mmu-miR-138 AGCUGGUGUUGUGAAUCAGGCCG mmu-mir-138-1 Mus musculus miR-138-1 stem-loop
mmu-mir-138-2 Mus musculus miR-138-2 stem-loop
mmu-miR-138-1* CGGCUACUUCACAACACCAGGG mmu-mir-138-1 Mus musculus miR-138-1 stem-loop
mmu-miR-138-2* GCUAUUUCACGACACCAGGGU mmu-mir-138-2 Mus musculus miR-138-2 stem-loop
mmu-miR-139-5p UCUACAGUGCACGUGUCUCCAG mmu-mir-139 Mus musculus miR-139 stem-loop
mmu-miR-139-3p UGGAGACGCGGCCCUGUUGGAG mmu-mir-139 Mus musculus miR-139 stem-loop
mmu-miR-140 CAGUGGUUUUACCCUAUGGUAG mmu-mir-140 Mus musculus miR-140 stem-loop
mmu-miR-140* UACCACAGGGUAGAACCACGG mmu-mir-140 Mus musculus miR-140 stem-loop
mmu-miR-141* CAUCUUCCAGUGCAGUGUUGGA mmu-mir-141 Mus musculus miR-141 stem-loop
mmu-miR-141 UAACACUGUCUGGUAAAGAUGG mmu-mir-141 Mus musculus miR-141 stem-loop
mmu-miR-142-5p CAUAAAGUAGAAAGCACUACU mmu-mir-142 Mus musculus miR-142 stem-loop
mmu-miR-142-3p UGUAGUGUUUCCUACUUUAUGGA mmu-mir-142 Mus musculus miR-142 stem-loop
mmu-miR-143* GGUGCAGUGCUGCAUCUCUGG mmu-mir-143 Mus musculus miR-143 stem-loop
mmu-miR-143 UGAGAUGAAGCACUGUAGCUC mmu-mir-143 Mus musculus miR-143 stem-loop
mmu-miR-144* GGAUAUCAUCAUAUACUGUAAGU mmu-mir-144 Mus musculus miR-144 stem-loop
mmu-miR-144 UACAGUAUAGAUGAUGUACU mmu-mir-144 Mus musculus miR-144 stem-loop
mmu-miR-145 GUCCAGUUUUCCCAGGAAUCCCU mmu-mir-145 Mus musculus miR-145 stem-loop
mmu-miR-145* AUUCCUGGAAAUACUGUUCUUG mmu-mir-145 Mus musculus miR-145 stem-loop
mmu-miR-146a UGAGAACUGAAUUCCAUGGGUU mmu-mir-146a Mus musculus miR-146a stem-loop
mmu-miR-146a* CCUGUGAAAUUCAGUUCUUCAG mmu-mir-146a Mus musculus miR-146a stem-loop
mmu-miR-146b UGAGAACUGAAUUCCAUAGGCU mmu-mir-146b Mus musculus miR-146b stem-loop
mmu-miR-146b* GCCCUAGGGACUCAGUUCUGGU mmu-mir-146b Mus musculus miR-146b stem-loop
mmu-miR-147* UGGAAACAUUUCUGCACAAACUAG mmu-mir-147 Mus musculus miR-147 stem-loop
mmu-miR-147 GUGUGCGGAAAUGCUUCUGCUA mmu-mir-147 Mus musculus miR-147 stem-loop
mmu-miR-148a* AAAGUUCUGAGACACUCCGACU mmu-mir-148a Mus musculus miR-148a stem-loop
mmu-miR-148a UCAGUGCACUACAGAACUUUGU mmu-mir-148a Mus musculus miR-148a stem-loop
mmu-miR-148b* GAAGUUCUGUUAUACACUCAGGCU mmu-mir-148b Mus musculus miR-148b stem-loop
mmu-miR-148b UCAGUGCAUCACAGAACUUUGU mmu-mir-148b Mus musculus miR-148b stem-loop
mmu-miR-149 UCUGGCUCCGUGUCUUCACUCCC mmu-mir-149 Mus musculus miR-149 stem-loop
mmu-miR-149* GAGGGAGGGACGGGGGCGGUGC mmu-mir-149 Mus musculus miR-149 stem-loop
mmu-miR-150 UCUCCCAACCCUUGUACCAGUG mmu-mir-150 Mus musculus miR-150 stem-loop
mmu-miR-150* CUGGUACAGGCCUGGGGGAUAG mmu-mir-150 Mus musculus miR-150 stem-loop
mmu-miR-151-5p UCGAGGAGCUCACAGUCUAGU mmu-mir-151 Mus musculus miR-151 stem-loop
mmu-miR-151-3p CUAGACUGAGGCUCCUUGAGG mmu-mir-151 Mus musculus miR-151 stem-loop
mmu-miR-152* UAGGUUCUGUGAUACACUCCGACU mmu-mir-152 Mus musculus miR-152 stem-loop
mmu-miR-152 UCAGUGCAUGACAGAACUUGG mmu-mir-152 Mus musculus miR-152 stem-loop
mmu-miR-153* UUUGUGACGUUGCAGCU mmu-mir-153 Mus musculus miR-153 stem-loop
mmu-miR-153 UUGCAUAGUCACAAAAGUGAUC mmu-mir-153 Mus musculus miR-153 stem-loop
mmu-miR-154 UAGGUUAUCCGUGUUGCCUUCG mmu-mir-154 Mus musculus miR-154 stem-loop
mmu-miR-154* AAUCAUACACGGUUGACCUAUU mmu-mir-154 Mus musculus miR-154 stem-loop
mmu-miR-155 UUAAUGCUAAUUGUGAUAGGGGU mmu-mir-155 Mus musculus miR-155 stem-loop
mmu-miR-155* CUCCUACCUGUUAGCAUUAAC mmu-mir-155 Mus musculus miR-155 stem-loop
mmu-miR-15a UAGCAGCACAUAAUGGUUUGUG mmu-mir-15a Mus musculus miR-15a stem-loop
mmu-miR-15a* CAGGCCAUACUGUGCUGCCUCA mmu-mir-15a Mus musculus miR-15a stem-loop
mmu-miR-15b UAGCAGCACAUCAUGGUUUACA mmu-mir-15b Mus musculus miR-15b stem-loop
mmu-miR-15b* CGAAUCAUUAUUUGCUGCUCUA mmu-mir-15b Mus musculus miR-15b stem-loop
mmu-miR-16 UAGCAGCACGUAAAUAUUGGCG mmu-mir-16-1 Mus musculus miR-16-1 stem-loop
mmu-mir-16-2 Mus musculus miR-16-2 stem-loop
mmu-miR-16-1* CCAGUAUUGACUGUGCUGCUGA mmu-mir-16-1 Mus musculus miR-16-1 stem-loop
mmu-miR-16-2* ACCAAUAUUAUUGUGCUGCUUU mmu-mir-16-2 Mus musculus miR-16-2 stem-loop
mmu-miR-17 CAAAGUGCUUACAGUGCAGGUAG mmu-mir-17 Mus musculus miR-17 stem-loop
mmu-miR-17* ACUGCAGUGAGGGCACUUGUAG mmu-mir-17 Mus musculus miR-17 stem-loop
mmu-miR-181a AACAUUCAACGCUGUCGGUGAGU mmu-mir-181a-1 Mus musculus miR-181a-1 stem-loop
mmu-mir-181a-2 Mus musculus mir-181a-2 stem-loop
mmu-miR-181a-1* ACCAUCGACCGUUGAUUGUACC mmu-mir-181a-1 Mus musculus miR-181a-1 stem-loop
mmu-miR-181a-2* ACCGACCGUUGACUGUACCUUG mmu-mir-181a-2 Mus musculus mir-181a-2 stem-loop
mmu-miR-181b AACAUUCAUUGCUGUCGGUGGGU mmu-mir-181b-1 Mus musculus miR-181b-1 stem-loop
mmu-mir-181b-2 Mus musculus miR-181b-2 stem-loop
mmu-miR-181b-1* CUCACUGAACAAUGAAUGC mmu-mir-181b-1 Mus musculus miR-181b-1 stem-loop
mmu-miR-181b-2* CUCACUGAUCAAUGAAUGCAAA mmu-mir-181b-2 Mus musculus miR-181b-2 stem-loop
mmu-miR-181c AACAUUCAACCUGUCGGUGAGU mmu-mir-181c Mus musculus miR-181c stem-loop
mmu-miR-181c* ACCAUCGACCGUUGAGUGGACC mmu-mir-181c Mus musculus miR-181c stem-loop
mmu-miR-181d AACAUUCAUUGUUGUCGGUGGGU mmu-mir-181d Mus musculus miR-181d stem-loop
mmu-miR-181d* CCCACCGGGGGAUGAAUGUCA mmu-mir-181d Mus musculus miR-181d stem-loop
mmu-miR-182 UUUGGCAAUGGUAGAACUCACACCG mmu-mir-182 Mus musculus miR-182 stem-loop
mmu-miR-182* GUGGUUCUAGACUUGCCAACU mmu-mir-182 Mus musculus miR-182 stem-loop
mmu-miR-183 UAUGGCACUGGUAGAAUUCACU mmu-mir-183 Mus musculus miR-183 stem-loop
mmu-miR-183* GUGAAUUACCGAAGGGCCAUAA mmu-mir-183 Mus musculus miR-183 stem-loop
mmu-miR-1839-5p AAGGUAGAUAGAACAGGUCUUG mmu-mir-1839 Mus musculus miR-1839 stem-loop
mmu-miR-1839-3p AGACCUACUUAUCUACCAACAGC mmu-mir-1839 Mus musculus miR-1839 stem-loop
mmu-miR-184 UGGACGGAGAACUGAUAAGGGU mmu-mir-184 Mus musculus miR-184 stem-loop
mmu-miR-1843-5p UAUGGAGGUCUCUGUCUGACU mmu-mir-1843 Mus musculus miR-1843 stem-loop
mmu-miR-1843-3p UCUGAUCGUUCACCUCCAUACA mmu-mir-1843 Mus musculus miR-1843 stem-loop
mmu-miR-185 UGGAGAGAAAGGCAGUUCCUGA mmu-mir-185 Mus musculus miR-185 stem-loop
mmu-miR-185* AGGGGCUGGCUUUCCUCUGGU mmu-mir-185 Mus musculus miR-185 stem-loop
mmu-miR-186 CAAAGAAUUCUCCUUUUGGGCU mmu-mir-186 Mus musculus miR-186 stem-loop
mmu-miR-186* GCCCUAAGGUGAAUUUUUUGGG mmu-mir-186 Mus musculus miR-186 stem-loop
mmu-miR-187* AGGCUACAACACAGGACCCGGG mmu-mir-187 Mus musculus miR-187 stem-loop
mmu-miR-187 UCGUGUCUUGUGUUGCAGCCGG mmu-mir-187 Mus musculus miR-187 stem-loop
mmu-miR-188-5p CAUCCCUUGCAUGGUGGAGGG mmu-mir-188 Mus musculus miR-188 stem-loop
mmu-miR-188-3p CUCCCACAUGCAGGGUUUGCA mmu-mir-188 Mus musculus miR-188 stem-loop
mmu-miR-1892 AUUUGGGGACGGGAGGGAGGAU mmu-mir-1892 Mus musculus miR-1892 stem-loop
mmu-miR-1893 GGCGCGGGCGCUGGACGCCUCG mmu-mir-1893 Mus musculus miR-1893 stem-loop
mmu-miR-1894-5p CUCUCCCCUACCACCUGCCUCU mmu-mir-1894 Mus musculus miR-1894 stem-loop
mmu-miR-1894-3p GCAAGGGAGAGGGUGAAGGGAG mmu-mir-1894 Mus musculus miR-1894 stem-loop
mmu-miR-1895 CCCCCGAGGAGGACGAGGAGGA mmu-mir-1895 Mus musculus miR-1895 stem-loop
mmu-miR-1896 CUCUCUGAUGGUGGGUGAGGAG mmu-mir-1896 Mus musculus miR-1896 stem-loop
mmu-miR-1897-5p CUUUGGAUGGAGAAAGAGGGGG mmu-mir-1897 Mus musculus miR-1897 stem-loop
mmu-miR-1897-3p UCAACUCGUUCUGUCCGGUGAG mmu-mir-1897 Mus musculus miR-1897 stem-loop
mmu-miR-1898 AGGUCAAGGUUCACAGGGGAUC mmu-mir-1898 Mus musculus miR-1898 stem-loop
mmu-miR-1899 AGCGAUGGCCGAAUCUGCUUCC mmu-mir-1899 Mus musculus miR-1899 stem-loop
mmu-miR-18a UAAGGUGCAUCUAGUGCAGAUAG mmu-mir-18a Mus musculus miR-18a stem-loop
mmu-miR-18a* ACUGCCCUAAGUGCUCCUUCUG mmu-mir-18a Mus musculus miR-18a stem-loop
mmu-miR-18b UAAGGUGCAUCUAGUGCUGUUAG mmu-mir-18b Mus musculus miR-18b stem-loop
mmu-miR-18b* UACUGCCCUAAAUGCCCCUUCU mmu-mir-18b Mus musculus miR-18b stem-loop
mmu-miR-190 UGAUAUGUUUGAUAUAUUAGGU mmu-mir-190 Mus musculus miR-190 stem-loop
mmu-miR-190* ACUAUAUAUCAAGCAUAUUCCU mmu-mir-190 Mus musculus miR-190 stem-loop
mmu-miR-1900 GGCCGCCCUCUCUGGUCCUUCA mmu-mir-1900 Mus musculus miR-1900 stem-loop
mmu-miR-1901 CCGCUCGUACUCCCGGGGGUCC mmu-mir-1901 Mus musculus miR-1901 stem-loop
mmu-miR-1902 AGAGGUGCAGUAGGCAUGACUU mmu-mir-1902 Mus musculus miR-1902 stem-loop
mmu-miR-1903 CCUUCUUCUUCUUCCUGAGACA mmu-mir-1903 Mus musculus miR-1903 stem-loop
mmu-miR-1904 GUUCUGCUCCUCUGGAGGGAGG mmu-mir-1904 Mus musculus miR-1904 stem-loop
mmu-miR-1905 CACCAGUCCCACCACGCGGUAG mmu-mir-1905 Mus musculus miR-1905 stem-loop
mmu-miR-1906 UGCAGCAGCCUGAGGCAGGGCU mmu-mir-1906-1 Mus musculus miR-1906-1 stem-loop
mmu-mir-1906-2 Mus musculus miR-1906-2 stem-loop
mmu-miR-1907 GAGCAGCAGAGGAUCUGGAGGU mmu-mir-1907 Mus musculus miR-1907 stem-loop
mmu-miR-190b UGAUAUGUUUGAUAUUGGGUU mmu-mir-190b Mus musculus miR-190b stem-loop
mmu-miR-190b* ACUGAAUGUCAAGCAUACUCUCA mmu-mir-190b Mus musculus miR-190b stem-loop
mmu-miR-191 CAACGGAAUCCCAAAAGCAGCUG mmu-mir-191 Mus musculus miR-191 stem-loop
mmu-miR-191* GCUGCACUUGGAUUUCGUUCCC mmu-mir-191 Mus musculus miR-191 stem-loop
mmu-miR-1912* UGCUCAUUGCAUGGGCUGUGUA mmu-mir-1912 Mus musculus miR-1912 stem-loop
mmu-miR-1912 CACAGAACAUGCAGUGAGAACU mmu-mir-1912 Mus musculus miR-1912 stem-loop
mmu-miR-192 CUGACCUAUGAAUUGACAGCC mmu-mir-192 Mus musculus miR-192 stem-loop
mmu-miR-192* CUGCCAAUUCCAUAGGUCACAG mmu-mir-192 Mus musculus miR-192 stem-loop
mmu-miR-1927 GACCUCUGGAUGUUAGGGACUGA mmu-mir-1927 Mus musculus miR-1927 stem-loop
mmu-miR-1928 AGCUACAUUGCCAGCUC mmu-mir-1928 Mus musculus miR-1928 stem-loop
mmu-miR-1929 UUCUAGGACUUUAUAGAGCAGAG mmu-mir-1929 Mus musculus miR-1929 stem-loop
mmu-miR-193* UGGGUCUUUGCGGGCAAGAUGA mmu-mir-193 Mus musculus miR-193 stem-loop
mmu-miR-193 AACUGGCCUACAAAGUCCCAGU mmu-mir-193 Mus musculus miR-193 stem-loop
mmu-miR-1930 ACCUCCAUAGUACCUGCAGCGU mmu-mir-1930 Mus musculus miR-1930 stem-loop
mmu-miR-1930* GGUGCAGUUACUGUGGCUGUGG mmu-mir-1930 Mus musculus miR-1930 stem-loop
mmu-miR-1931 AUGCAAGGGCUGGUGCGAUGGC mmu-mir-1931 Mus musculus miR-1931 stem-loop
mmu-miR-1932 GUUGCGGACAGCGCUAGGUCGG mmu-mir-1932 Mus musculus miR-1932 stem-loop
mmu-miR-1933-5p AGUCAUGGUGUUCGGUCUUAGUUU mmu-mir-1933 Mus musculus miR-1933 stem-loop
mmu-miR-1933-3p CCAGGACCAUCAGUGUGACUAU mmu-mir-1933 Mus musculus miR-1933 stem-loop
mmu-miR-1934 UCUGGUCCCCUGCUUCGUCCUCU mmu-mir-1934 Mus musculus miR-1934 stem-loop
mmu-miR-1934* AGGAUGACGGUGGGGCUGGUGA mmu-mir-1934 Mus musculus miR-1934 stem-loop
mmu-miR-1935 AGGCAGAGGCUGGCGGAUCUCU mmu-mir-1935 Mus musculus miR-1935 stem-loop
mmu-miR-1936 UAACUGACCUGCUGUGAACUGGC mmu-mir-1936 Mus musculus miR-1936 stem-loop
mmu-miR-1937a AAUCCCGGACGAGCCCCCA mmu-mir-1937a Mus musculus miR-1937a stem-loop
mmu-miR-1937b AUCCCGGACGAGCCCCCA mmu-mir-1937b-1 Mus musculus miR-1937b-1 stem-loop
mmu-mir-1937b-2 Mus musculus miR-1937b-2 stem-loop
mmu-mir-1937b-3 Mus musculus miR-1937b-3 stem-loop
mmu-mir-1937b-4 Mus musculus miR-1937b-4 stem-loop
mmu-mir-1937b-5 Mus musculus miR-1937b-5 stem-loop
mmu-miR-1937c AUCCCGGAAGAGCCCCCA mmu-mir-1937c Mus musculus miR-1937c stem-loop
mmu-miR-1938 CGGUGGGACUUGUAGUUCGGUC mmu-mir-1938 Mus musculus miR-1938 stem-loop
mmu-miR-1939 UCGAUUCCCUGCCAAUGCAC mmu-mir-1939 Mus musculus miR-1939 stem-loop
mmu-miR-193b* CGGGGUUUUGAGGGCGAGAUGA mmu-mir-193b Mus musculus miR-193b stem-loop
mmu-miR-193b AACUGGCCCACAAAGUCCCGCU mmu-mir-193b Mus musculus miR-193b stem-loop
mmu-miR-194 UGUAACAGCAACUCCAUGUGGA mmu-mir-194-1 Mus musculus miR-194-1 stem-loop
mmu-mir-194-2 Mus musculus miR-194-2 stem-loop
mmu-miR-194-1* CCAGUGGAGCUGCUGUUACUUC mmu-mir-194-1 Mus musculus miR-194-1 stem-loop
mmu-miR-194-2* CCAGUGGGGCUGCUGUUAUCUG mmu-mir-194-2 Mus musculus miR-194-2 stem-loop
mmu-miR-1940 AUGGAGGACUGAGAAGGUGGAGCAGUU mmu-mir-1940 Mus musculus miR-1940 stem-loop
mmu-miR-1941-5p AGGGAGAUGCUGGUACAGAGGCUU mmu-mir-1941 Mus musculus miR-1941 stem-loop
mmu-miR-1941-3p CAUCUUAGCAGUAUCUCCCAU mmu-mir-1941 Mus musculus miR-1941 stem-loop
mmu-miR-1942 UCAGAUGUCUUCAUCUGGUUG mmu-mir-1942 Mus musculus miR-1942 stem-loop
mmu-miR-1943 AAGGGAGGAUCUGGGCACCUGGA mmu-mir-1943 Mus musculus miR-1943 stem-loop
mmu-miR-1943* CAGGUGCCAGCUCCUCCCUUC mmu-mir-1943 Mus musculus miR-1943 stem-loop
mmu-miR-1944 CUCUGUGCUGAAUGUCAAGUUCUGAUU mmu-mir-1944 Mus musculus miR-1944 stem-loop
mmu-miR-1945 UCUUCGCGGGUACUGUCGGGAC mmu-mir-1945 Mus musculus miR-1945 stem-loop
mmu-miR-1946a AGCCGGGCAGUGGUGGCACACACUUUU mmu-mir-1946a Mus musculus miR-1946a stem-loop
mmu-miR-1946b GCCGGGCAGUGGUGGCACAUGCUUUU mmu-mir-1946b Mus musculus miR-1946b stem-loop
mmu-miR-1947 AGGACGAGCUAGCUGAGUGCUG mmu-mir-1947 Mus musculus miR-1947 stem-loop
mmu-miR-1947* GCACUGAGCUAGCUCUCCCUCC mmu-mir-1947 Mus musculus miR-1947 stem-loop
mmu-miR-1948* AUAUGAGUAUUCUGCCUAAAU mmu-mir-1948 Mus musculus miR-1948 stem-loop
mmu-miR-1948 UUUAGGCAGAGCACUCGUACAG mmu-mir-1948 Mus musculus miR-1948 stem-loop
mmu-miR-1949 CUAUACCAGGAUGUCAGCAUAGUU mmu-mir-1949 Mus musculus miR-1949 stem-loop
mmu-miR-195 UAGCAGCACAGAAAUAUUGGC mmu-mir-195 Mus musculus miR-195 stem-loop
mmu-miR-195* CCAAUAUUGGCUGUGCUGCUCC mmu-mir-195 Mus musculus miR-195 stem-loop
mmu-miR-1950 UCUGCAUCUAAGGAUAUGGUCA mmu-mir-1950 Mus musculus miR-1950 stem-loop
mmu-miR-1951 GUAGUGGAGACUGGUGUGGCUA mmu-mir-1951 Mus musculus miR-1951 stem-loop
mmu-miR-1952 UCUCCACCCUCCUUCUG mmu-mir-1952 Mus musculus miR-1952 stem-loop
mmu-miR-1953 UGGGAAAGUUCUCAGGCUUCUG mmu-mir-1953 Mus musculus miR-1953 stem-loop
mmu-miR-1954 ACUGCAGAGUGAGACCCUGUU mmu-mir-1954 Mus musculus miR-1954 stem-loop
mmu-miR-1955-5p AGUCCCAGGAUGCACUGCAGCUUUU mmu-mir-1955 Mus musculus miR-1955 stem-loop
mmu-miR-1955-3p GAGCAUUGCAUGCUGGGACAU mmu-mir-1955 Mus musculus miR-1955 stem-loop
mmu-miR-1956 AGUCCAGGGCUGAGUCAGCGGA mmu-mir-1956 Mus musculus miR-1956 stem-loop
mmu-miR-1957 CAGUGGUAGAGCAUAUGAC mmu-mir-1957 Mus musculus miR-1957 stem-loop
mmu-miR-1958 UAGGAAAGUGGAAGCAGUAAGU mmu-mir-1958 Mus musculus miR-1958 stem-loop
mmu-miR-1959 GGGGAUGUAGCUCAGUGGAG mmu-mir-1959 Mus musculus miR-1959 stem-loop
mmu-miR-1960 CCAGUGCUGUUAGAAGAGGGCU mmu-mir-1960 Mus musculus miR-1960 stem-loop
mmu-miR-1961 UGAGGUAGUAGUUAGAA mmu-mir-1961 Mus musculus miR-1961 stem-loop
mmu-miR-1962 AGAGGCUGGCACUGGGACACAU mmu-mir-1962 Mus musculus miR-1962 stem-loop
mmu-miR-1963 UGGGACGAGAUCAUGAGGCCUUC mmu-mir-1963 Mus musculus miR-1963 stem-loop
mmu-miR-1964-5p AGCUGGAGCACAAAAGCCGGUG mmu-mir-1964 Mus musculus miR-1964 stem-loop
mmu-miR-1964-3p CCGACUUCUGGGCUCCGGCUUU mmu-mir-1964 Mus musculus miR-1964 stem-loop
mmu-miR-1965 AAGCCGGGCCGUAGUGGCGCA mmu-mir-1965 Mus musculus miR-1965 stem-loop
mmu-miR-1966 AAGGGAGCUGGCUCAGGAGAGAGUC mmu-mir-1966 Mus musculus miR-1966 stem-loop
mmu-miR-1967 UGAGGAUCCUGGGGAGAAGAUGC mmu-mir-1967 Mus musculus miR-1967 stem-loop
mmu-miR-1968 UGCAGCUGUUAAGGAUGGUGGACU mmu-mir-1968 Mus musculus miR-1968 stem-loop
mmu-miR-1968* ACCACCUCUGCAGCUGUUAAG mmu-mir-1968 Mus musculus miR-1968 stem-loop
mmu-miR-1969 AAGAUGGAGACUUUAACAUGGGU mmu-mir-1969 Mus musculus miR-1969 stem-loop
mmu-miR-196a UAGGUAGUUUCAUGUUGUUGGG mmu-mir-196a-1 Mus musculus miR-196a-1 stem-loop
mmu-mir-196a-2 Mus musculus miR-196a-2 stem-loop
mmu-miR-196a-1* CAACGACAUCAAACCACCUGAU mmu-mir-196a-1 Mus musculus miR-196a-1 stem-loop
mmu-miR-196a-2* UCGGCAACAAGAAACUGCCUGA mmu-mir-196a-2 Mus musculus miR-196a-2 stem-loop
mmu-miR-196b UAGGUAGUUUCCUGUUGUUGGG mmu-mir-196b Mus musculus miR-196b stem-loop
mmu-miR-196b* UCGACAGCACGACACUGCCUUC mmu-mir-196b Mus musculus miR-196b stem-loop
mmu-miR-1970 UGUGUCACUGGGGAUAGGCUUUG mmu-mir-1970 Mus musculus miR-1970 stem-loop
mmu-miR-1971 GUAAAGGCUGGGCUGAGA mmu-mir-1971 Mus musculus miR-1971 stem-loop
mmu-miR-1981 GUAAAGGCUGGGCUUAGACGUGGC mmu-mir-1981 Mus musculus miR-1981 stem-loop
mmu-miR-1981* CAUCUAACCCUGGCCUUUGAC mmu-mir-1981 Mus musculus miR-1981 stem-loop
mmu-miR-1982* UUGGGAGGGUCCUGGGGAGG mmu-mir-1982 Mus musculus miR-1982 stem-loop
mmu-miR-1982.1 UCUCACCCUAUGUUCUCCCACAG mmu-mir-1982 Mus musculus miR-1982 stem-loop
mmu-miR-1982.2 UCACCCUAUGUUCUCCCACAG mmu-mir-1982 Mus musculus miR-1982 stem-loop
mmu-miR-1983 CUCACCUGGAGCAUGUUUUCU mmu-mir-1983 Mus musculus miR-1983 stem-loop
mmu-miR-199a-5p CCCAGUGUUCAGACUACCUGUUC mmu-mir-199a-1 Mus musculus miR-199a-1 stem-loop
mmu-mir-199a-2 Mus musculus miR-199a-2 stem-loop
mmu-miR-199a-3p ACAGUAGUCUGCACAUUGGUUA mmu-mir-199a-1 Mus musculus miR-199a-1 stem-loop
mmu-mir-199a-2 Mus musculus miR-199a-2 stem-loop
mmu-miR-199b* CCCAGUGUUUAGACUACCUGUUC mmu-mir-199b Mus musculus miR-199b stem-loop
mmu-miR-199b ACAGUAGUCUGCACAUUGGUUA mmu-mir-199b Mus musculus miR-199b stem-loop
mmu-miR-19a* UAGUUUUGCAUAGUUGCACUAC mmu-mir-19a Mus musculus miR-19a stem-loop
mmu-miR-19a UGUGCAAAUCUAUGCAAAACUGA mmu-mir-19a Mus musculus miR-19a stem-loop
mmu-miR-19b-1* AGUUUUGCAGGUUUGCAUCCAGC mmu-mir-19b-1 Mus musculus miR-19b-1 stem-loop
mmu-miR-19b UGUGCAAAUCCAUGCAAAACUGA mmu-mir-19b-1 Mus musculus miR-19b-1 stem-loop
mmu-mir-19b-2 Mus musculus miR-19b-2 stem-loop
mmu-miR-19b-2* AGUUUUGCAGAUUUGCAGUUCAGC mmu-mir-19b-2 Mus musculus miR-19b-2 stem-loop
mmu-miR-200a* CAUCUUACCGGACAGUGCUGGA mmu-mir-200a Mus musculus miR-200a stem-loop
mmu-miR-200a UAACACUGUCUGGUAACGAUGU mmu-mir-200a Mus musculus miR-200a stem-loop
mmu-miR-200b* CAUCUUACUGGGCAGCAUUGGA mmu-mir-200b Mus musculus miR-200b stem-loop
mmu-miR-200b UAAUACUGCCUGGUAAUGAUGA mmu-mir-200b Mus musculus miR-200b stem-loop
mmu-miR-200c* CGUCUUACCCAGCAGUGUUUGG mmu-mir-200c Mus musculus miR-200c stem-loop
mmu-miR-200c UAAUACUGCCGGGUAAUGAUGGA mmu-mir-200c Mus musculus miR-200c stem-loop
mmu-miR-201 UACUCAGUAAGGCAUUGUUCUU mmu-mir-201 Mus musculus miR-201 stem-loop
mmu-miR-201* UGAACAGUGCCUUUCUGUGUAGG mmu-mir-201 Mus musculus miR-201 stem-loop
mmu-miR-202-5p UUCCUAUGCAUAUACUUCUUU mmu-mir-202 Mus musculus miR-202 stem-loop
mmu-miR-202-3p AGAGGUAUAGCGCAUGGGAAGA mmu-mir-202 Mus musculus miR-202 stem-loop
mmu-miR-203* AGUGGUUCUUGACAGUUCAACA mmu-mir-203 Mus musculus miR-203 stem-loop
mmu-miR-203 GUGAAAUGUUUAGGACCACUAG mmu-mir-203 Mus musculus miR-203 stem-loop
mmu-miR-204 UUCCCUUUGUCAUCCUAUGCCU mmu-mir-204 Mus musculus miR-204 stem-loop
mmu-miR-204* GCUGGGAAGGCAAAGGGACGU mmu-mir-204 Mus musculus miR-204 stem-loop
mmu-miR-205 UCCUUCAUUCCACCGGAGUCUG mmu-mir-205 Mus musculus miR-205 stem-loop
mmu-miR-205* GAUUUCAGUGGAGUGAAGCUCA mmu-mir-205 Mus musculus miR-205 stem-loop
mmu-miR-206* ACAUGCUUCUUUAUAUCCUCAUA mmu-mir-206 Mus musculus miR-206 stem-loop
mmu-miR-206 UGGAAUGUAAGGAAGUGUGUGG mmu-mir-206 Mus musculus miR-206 stem-loop
mmu-miR-207 GCUUCUCCUGGCUCUCCUCCCUC mmu-mir-207 Mus musculus miR-207 stem-loop
mmu-miR-208a-5p GAGCUUUUGGCCCGGGUUAUAC mmu-mir-208a Mus musculus miR-208a stem-loop
mmu-miR-208a-3p AUAAGACGAGCAAAAAGCUUGU mmu-mir-208a Mus musculus miR-208a stem-loop
mmu-miR-208b* AAGCUUUUUGCUCGCGUUAUGU mmu-mir-208b Mus musculus miR-208b stem-loop
mmu-miR-208b AUAAGACGAACAAAAGGUUUGU mmu-mir-208b Mus musculus miR-208b stem-loop
mmu-miR-20a UAAAGUGCUUAUAGUGCAGGUAG mmu-mir-20a Mus musculus miR-20a stem-loop
mmu-miR-20a* ACUGCAUUACGAGCACUUAAAG mmu-mir-20a Mus musculus miR-20a stem-loop
mmu-miR-20b CAAAGUGCUCAUAGUGCAGGUAG mmu-mir-20b Mus musculus miR-20b stem-loop
mmu-miR-20b* ACUGCAGUGUGAGCACUUCUAG mmu-mir-20b Mus musculus miR-20b stem-loop
mmu-miR-21 UAGCUUAUCAGACUGAUGUUGA mmu-mir-21 Mus musculus miR-21 stem-loop
mmu-miR-21* CAACAGCAGUCGAUGGGCUGUC mmu-mir-21 Mus musculus miR-21 stem-loop
mmu-miR-210* AGCCACUGCCCACCGCACACUG mmu-mir-210 Mus musculus miR-210 stem-loop
mmu-miR-210 CUGUGCGUGUGACAGCGGCUGA mmu-mir-210 Mus musculus miR-210 stem-loop
mmu-miR-211 UUCCCUUUGUCAUCCUUUGCCU mmu-mir-211 Mus musculus miR-211 stem-loop
mmu-miR-211* GCAAGGACAGCAAAGGGGGGC mmu-mir-211 Mus musculus miR-211 stem-loop
mmu-miR-212-5p ACCUUGGCUCUAGACUGCUUACU mmu-mir-212 Mus musculus miR-212 stem-loop
mmu-miR-212-3p UAACAGUCUCCAGUCACGGCCA mmu-mir-212 Mus musculus miR-212 stem-loop
mmu-miR-2136 CUGGGUGUUGACUGAGAUGUG mmu-mir-2136 Mus musculus miR-2136 stem-loop
mmu-miR-2137 GCCGGCGGGAGCCCCAGGGAG mmu-mir-2137 Mus musculus miR-2137 stem-loop
mmu-miR-2139 AGCUGCGCUGCUCCUGGUAACUGC mmu-mir-2139 Mus musculus miR-2139 stem-loop
mmu-miR-214* UGCCUGUCUACACUUGCUGUGC mmu-mir-214 Mus musculus miR-214 stem-loop
mmu-miR-214 ACAGCAGGCACAGACAGGCAGU mmu-mir-214 Mus musculus miR-214 stem-loop
mmu-miR-2145 AGCAGGGUCGGGCCUGGUU mmu-mir-2145-1 Mus musculus miR-2145-1 stem-loop
mmu-mir-2145-2 Mus musculus miR-2145-2 stem-loop
mmu-miR-215 AUGACCUAUGAUUUGACAGAC mmu-mir-215 Mus musculus miR-215 stem-loop
mmu-miR-215* UCUGUCAUUCUGUAGGCCAAU mmu-mir-215 Mus musculus miR-215 stem-loop
mmu-miR-216a UAAUCUCAGCUGGCAACUGUGA mmu-mir-216a Mus musculus miR-216a stem-loop
mmu-miR-216a* CACAGUGGUCUCUGGGAUUAUG mmu-mir-216a Mus musculus miR-216a stem-loop
mmu-miR-216b AAAUCUCUGCAGGCAAAUGUGA mmu-mir-216b Mus musculus mir-216b stem-loop
mmu-miR-216b* ACACUUACCUGUAGAGAUUCUU mmu-mir-216b Mus musculus mir-216b stem-loop
mmu-miR-217 UACUGCAUCAGGAACUGACUGGA mmu-mir-217 Mus musculus miR-217 stem-loop
mmu-miR-217* CAUCAGUUCCUAAUGCAUUGCCU mmu-mir-217 Mus musculus miR-217 stem-loop
mmu-miR-218 UUGUGCUUGAUCUAACCAUGU mmu-mir-218-1 Mus musculus miR-218-1 stem-loop
mmu-mir-218-2 Mus musculus miR-218-2 stem-loop
mmu-miR-218-1* AAACAUGGUUCCGUCAAGCACC mmu-mir-218-1 Mus musculus miR-218-1 stem-loop
mmu-miR-218-2* CAUGGUUCUGUCAAGCACCGCG mmu-mir-218-2 Mus musculus miR-218-2 stem-loop
mmu-miR-2182 ACGCCACAUUUCCCACGCCGCG mmu-mir-2182 Mus musculus miR-2182 stem-loop
mmu-miR-2183 UUGAACCCCUGACCUCCU mmu-mir-2183 Mus musculus miR-2183 stem-loop
mmu-miR-219-5p UGAUUGUCCAAACGCAAUUCU mmu-mir-219-1 Mus musculus miR-219-1 stem-loop
mmu-mir-219-2 Mus musculus miR-219-2 stem-loop
mmu-miR-219-3p* AGAGUUGCGUCUGGACGUCCCG mmu-mir-219-1 Mus musculus miR-219-1 stem-loop
mmu-miR-219-3p AGAAUUGUGGCUGGACAUCUGU mmu-mir-219-2 Mus musculus miR-219-2 stem-loop
mmu-miR-22* AGUUCUUCAGUGGCAAGCUUUA mmu-mir-22 Mus musculus miR-22 stem-loop
mmu-miR-22 AAGCUGCCAGUUGAAGAACUGU mmu-mir-22 Mus musculus miR-22 stem-loop
mmu-miR-221* ACCUGGCAUACAAUGUAGAUUUCUGU mmu-mir-221 Mus musculus miR-221 stem-loop
mmu-miR-221 AGCUACAUUGUCUGCUGGGUUUC mmu-mir-221 Mus musculus miR-221 stem-loop
mmu-miR-222* UCAGUAGCCAGUGUAGAUCCU mmu-mir-222 Mus musculus miR-222 stem-loop
mmu-miR-222 AGCUACAUCUGGCUACUGGGU mmu-mir-222 Mus musculus miR-222 stem-loop
mmu-miR-223* CGUGUAUUUGACAAGCUGAGUUG mmu-mir-223 Mus musculus miR-223 stem-loop
mmu-miR-223 UGUCAGUUUGUCAAAUACCCCA mmu-mir-223 Mus musculus miR-223 stem-loop
mmu-miR-224 UAAGUCACUAGUGGUUCCGUU mmu-mir-224 Mus musculus miR-224 stem-loop
mmu-miR-224* AAAUGGUGCCCUAGUGACUACA mmu-mir-224 Mus musculus miR-224 stem-loop
mmu-miR-23a* GGGGUUCCUGGGGAUGGGAUUU mmu-mir-23a Mus musculus miR-23a stem-loop
mmu-miR-23a AUCACAUUGCCAGGGAUUUCC mmu-mir-23a Mus musculus miR-23a stem-loop
mmu-miR-23b* GGGUUCCUGGCAUGCUGAUUU mmu-mir-23b Mus musculus miR-23b stem-loop
mmu-miR-23b AUCACAUUGCCAGGGAUUACC mmu-mir-23b Mus musculus miR-23b stem-loop
mmu-miR-24-1* GUGCCUACUGAGCUGAUAUCAGU mmu-mir-24-1 Mus musculus miR-24-1 stem-loop
mmu-miR-24 UGGCUCAGUUCAGCAGGAACAG mmu-mir-24-1 Mus musculus miR-24-1 stem-loop
mmu-mir-24-2 Mus musculus miR-24-2 stem-loop
mmu-miR-24-2* GUGCCUACUGAGCUGAAACAGU mmu-mir-24-2 Mus musculus miR-24-2 stem-loop
mmu-miR-25* AGGCGGAGACUUGGGCAAUUGC mmu-mir-25 Mus musculus miR-25 stem-loop
mmu-miR-25 CAUUGCACUUGUCUCGGUCUGA mmu-mir-25 Mus musculus miR-25 stem-loop
mmu-miR-26a UUCAAGUAAUCCAGGAUAGGCU mmu-mir-26a-1 Mus musculus miR-26a-1 stem-loop
mmu-mir-26a-2 Mus musculus miR-26a-2 stem-loop
mmu-miR-26a-1* CCUAUUCUUGGUUACUUGCACG mmu-mir-26a-1 Mus musculus miR-26a-1 stem-loop
mmu-miR-26a-2* CCUGUUCUUGAUUACUUGUUUC mmu-mir-26a-2 Mus musculus miR-26a-2 stem-loop
mmu-miR-26b UUCAAGUAAUUCAGGAUAGGU mmu-mir-26b Mus musculus miR-26b stem-loop
mmu-miR-26b* CCUGUUCUCCAUUACUUGGCUC mmu-mir-26b Mus musculus miR-26b stem-loop
mmu-miR-27a* AGGGCUUAGCUGCUUGUGAGCA mmu-mir-27a Mus musculus miR-27a stem-loop
mmu-miR-27a UUCACAGUGGCUAAGUUCCGC mmu-mir-27a Mus musculus miR-27a stem-loop
mmu-miR-27b* AGAGCUUAGCUGAUUGGUGAAC mmu-mir-27b Mus musculus miR-27b stem-loop
mmu-miR-27b UUCACAGUGGCUAAGUUCUGC mmu-mir-27b Mus musculus miR-27b stem-loop
mmu-miR-28 AAGGAGCUCACAGUCUAUUGAG mmu-mir-28 Mus musculus miR-28 stem-loop
mmu-miR-28* CACUAGAUUGUGAGCUGCUGGA mmu-mir-28 Mus musculus miR-28 stem-loop
mmu-miR-2861 GGGGCCUGGCGGCGGGCGG mmu-mir-2861 Mus musculus miR-2861 stem-loop
mmu-miR-290-5p ACUCAAACUAUGGGGGCACUUU mmu-mir-290 Mus musculus miR-290 stem-loop
mmu-miR-290-3p AAAGUGCCGCCUAGUUUUAAGCCC mmu-mir-290 Mus musculus miR-290 stem-loop
mmu-miR-291a-5p CAUCAAAGUGGAGGCCCUCUCU mmu-mir-291a Mus musculus miR-291a stem-loop
mmu-miR-291a-3p AAAGUGCUUCCACUUUGUGUGC mmu-mir-291a Mus musculus miR-291a stem-loop
mmu-miR-291b-5p GAUCAAAGUGGAGGCCCUCUCC mmu-mir-291b Mus musculus miR-291b stem-loop
mmu-miR-291b-3p AAAGUGCAUCCAUUUUGUUUGU mmu-mir-291b Mus musculus miR-291b stem-loop
mmu-miR-292-5p ACUCAAACUGGGGGCUCUUUUG mmu-mir-292 Mus musculus miR-292 stem-loop
mmu-miR-292-3p AAAGUGCCGCCAGGUUUUGAGUGU mmu-mir-292 Mus musculus miR-292 stem-loop
mmu-miR-293* ACUCAAACUGUGUGACAUUUUG mmu-mir-293 Mus musculus miR-293 stem-loop
mmu-miR-293 AGUGCCGCAGAGUUUGUAGUGU mmu-mir-293 Mus musculus miR-293 stem-loop
mmu-miR-294* ACUCAAAAUGGAGGCCCUAUCU mmu-mir-294 Mus musculus miR-294 stem-loop
mmu-miR-294 AAAGUGCUUCCCUUUUGUGUGU mmu-mir-294 Mus musculus miR-294 stem-loop
mmu-miR-295* ACUCAAAUGUGGGGCACACUUC mmu-mir-295 Mus musculus miR-295 stem-loop
mmu-miR-295 AAAGUGCUACUACUUUUGAGUCU mmu-mir-295 Mus musculus miR-295 stem-loop
mmu-miR-296-5p AGGGCCCCCCCUCAAUCCUGU mmu-mir-296 Mus musculus miR-296 stem-loop
mmu-miR-296-3p GAGGGUUGGGUGGAGGCUCUCC mmu-mir-296 Mus musculus miR-296 stem-loop
mmu-miR-297a AUGUAUGUGUGCAUGUGCAUGU mmu-mir-297a-1 Mus musculus miR-297a-1 stem-loop
mmu-mir-297a-2 Mus musculus miR-297a-2 stem-loop
mmu-mir-297a-3 Mus musculus miR-297a-3 stem-loop
mmu-mir-297a-4 Mus musculus miR-297a-4 stem-loop
mmu-mir-297a-5 Mus musculus miR-297a-5 stem-loop
mmu-mir-297a-6 Mus musculus miR-297a-6 stem-loop
mmu-miR-297a* UAUACAUACACACAUACCCAUA mmu-mir-297a-3 Mus musculus miR-297a-3 stem-loop
mmu-mir-297a-4 Mus musculus miR-297a-4 stem-loop
mmu-miR-297a-5* AUAUACAUACGCACAUACCCAU mmu-mir-297a-5 Mus musculus miR-297a-5 stem-loop
mmu-miR-297b-5p AUGUAUGUGUGCAUGAACAUGU mmu-mir-297b Mus musculus miR-297b stem-loop
mmu-miR-297b-3p UAUACAUACACACAUACCCAUA mmu-mir-297b Mus musculus miR-297b stem-loop
mmu-miR-297c AUGUAUGUGUGCAUGUACAUGU mmu-mir-297c Mus musculus miR-297c stem-loop
mmu-miR-297c* UAUACAUACACACAUACCCAUA mmu-mir-297c Mus musculus miR-297c stem-loop
mmu-miR-298 GGCAGAGGAGGGCUGUUCUUCCC mmu-mir-298 Mus musculus miR-298 stem-loop
mmu-miR-298* GAGGAACUAGCCUUCUCUCAGC mmu-mir-298 Mus musculus miR-298 stem-loop
mmu-miR-299* UGGUUUACCGUCCCACAUACAU mmu-mir-299 Mus musculus miR-299 stem-loop
mmu-miR-299 UAUGUGGGACGGUAAACCGCUU mmu-mir-299 Mus musculus miR-299 stem-loop
mmu-miR-29a* ACUGAUUUCUUUUGGUGUUCAG mmu-mir-29a Mus musculus miR-29a stem-loop
mmu-miR-29a UAGCACCAUCUGAAAUCGGUUA mmu-mir-29a Mus musculus miR-29a stem-loop
mmu-miR-29b-1* GCUGGUUUCAUAUGGUGGUUUA mmu-mir-29b-1 Mus musculus miR-29b-1 stem-loop
mmu-miR-29b UAGCACCAUUUGAAAUCAGUGUU mmu-mir-29b-1 Mus musculus miR-29b-1 stem-loop
mmu-mir-29b-2 Mus musculus miR-29b-2 stem-loop
mmu-miR-29b-2* CUGGUUUCACAUGGUGGCUUAGAUU mmu-mir-29b-2 Mus musculus miR-29b-2 stem-loop
mmu-miR-29c* UGACCGAUUUCUCCUGGUGUUC mmu-mir-29c Mus musculus miR-29c stem-loop
mmu-miR-29c UAGCACCAUUUGAAAUCGGUUA mmu-mir-29c Mus musculus miR-29c stem-loop
mmu-miR-300* UUGAAGAGAGGUUAUCCUUUGU mmu-mir-300 Mus musculus miR-300 stem-loop
mmu-miR-300 UAUGCAAGGGCAAGCUCUCUUC mmu-mir-300 Mus musculus miR-300 stem-loop
mmu-miR-301a* GCUCUGACUUUAUUGCACUACU mmu-mir-301a Mus musculus miR-301a stem-loop
mmu-miR-301a CAGUGCAAUAGUAUUGUCAAAGC mmu-mir-301a Mus musculus miR-301a stem-loop
mmu-miR-301b* GCUCUGACUAGGUUGCACUACU mmu-mir-301b Mus musculus mir-301b stem-loop
mmu-miR-301b CAGUGCAAUGGUAUUGUCAAAGC mmu-mir-301b Mus musculus mir-301b stem-loop
mmu-miR-302a* ACUUAAACGUGGUUGUACUUGC mmu-mir-302a Mus musculus miR-302a stem-loop
mmu-miR-302a UAAGUGCUUCCAUGUUUUGGUGA mmu-mir-302a Mus musculus miR-302a stem-loop
mmu-miR-302b* ACUUUAACAUGGGAAUGCUUUCU mmu-mir-302b Mus musculus miR-302b stem-loop
mmu-miR-302b UAAGUGCUUCCAUGUUUUAGUAG mmu-mir-302b Mus musculus miR-302b stem-loop
mmu-miR-302c* GCUUUAACAUGGGGUUACCUGC mmu-mir-302c Mus musculus miR-302c stem-loop
mmu-miR-302c AAGUGCUUCCAUGUUUCAGUGG mmu-mir-302c Mus musculus miR-302c stem-loop
mmu-miR-302d* ACUUUAACAUGGAGGCACUUGCU mmu-mir-302d Mus musculus miR-302d stem-loop
mmu-miR-302d UAAGUGCUUCCAUGUUUGAGUGU mmu-mir-302d Mus musculus miR-302d stem-loop
mmu-miR-3057-5p AUUGGAGCUGAGAUUCUGCGGGAU mmu-mir-3057 Mus musculus miR-3057 stem-loop
mmu-miR-3057-3p UCCCACAGGCCCAGCUCAUAGC mmu-mir-3057 Mus musculus miR-3057 stem-loop
mmu-miR-3058 UCAGCCACGGCUUACCUGGAAGA mmu-mir-3058 Mus musculus miR-3058 stem-loop
mmu-miR-3058* UUCCUGUCAGCCGUGGGUGCC mmu-mir-3058 Mus musculus miR-3058 stem-loop
mmu-miR-3059 UUUCCUCUCUGCCCCAUAGGGU mmu-mir-3059 Mus musculus miR-3059 stem-loop
mmu-miR-3059* CCUCUAGGGAAGAGAAGGUUGG mmu-mir-3059 Mus musculus miR-3059 stem-loop
mmu-miR-3060* GGGAGUGCUUCGUGCUUCUG mmu-mir-3060 Mus musculus miR-3060 stem-loop
mmu-miR-3060 CCAUAGCACAGAAGCACUCCCA mmu-mir-3060 Mus musculus miR-3060 stem-loop
mmu-miR-3061-5p CAGUGGGCCGUGAAAGGUAGCC mmu-mir-3061 Mus musculus miR-3061 stem-loop
mmu-miR-3061-3p CUACCUUUGAUAGUCCACUGCC mmu-mir-3061 Mus musculus miR-3061 stem-loop
mmu-miR-3062 GGAGAAUGUAGUGUUACCGUGA mmu-mir-3062 Mus musculus miR-3062 stem-loop
mmu-miR-3062* CGGGGACACACUUUCUCCU mmu-mir-3062 Mus musculus miR-3062 stem-loop
mmu-miR-3063* UGGAGAUCAGGUUUGCACACU mmu-mir-3063 Mus musculus miR-3063 stem-loop
mmu-miR-3063 UGAGGAAUCCUGAUCUCUCGCC mmu-mir-3063 Mus musculus miR-3063 stem-loop
mmu-miR-3064-5p UCUGGCUGUUGUGGUGUGCAAA mmu-mir-3064 Mus musculus miR-3064 stem-loop
mmu-miR-3064-3p UGCCACACUGCAACACCUUACA mmu-mir-3064 Mus musculus miR-3064 stem-loop
mmu-miR-3065 UCAACAAAAUCACUGAUGCUGG mmu-mir-3065 Mus musculus miR-3065 stem-loop
mmu-miR-3065* UCAGCACCAGGAUAUUGUUGGGG mmu-mir-3065 Mus musculus miR-3065 stem-loop
mmu-miR-3066 UUGGUUGCUGUAGAUUAAGUAG mmu-mir-3066 Mus musculus miR-3066 stem-loop
mmu-miR-3066* CACUUAAUAGACCGCAACCUGC mmu-mir-3066 Mus musculus miR-3066 stem-loop
mmu-miR-3067 AGUUCUCAGGCCCGCUGUGGUGU mmu-mir-3067 Mus musculus miR-3067 stem-loop
mmu-miR-3067* CCAAGCGGCUGCCCUGGGAGAGG mmu-mir-3067 Mus musculus miR-3067 stem-loop
mmu-miR-3068 UUGGAGUUCAUGCAAGUUCUAACC mmu-mir-3068 Mus musculus miR-3068 stem-loop
mmu-miR-3068* GGUGAAUUGCAGUACUCCAACA mmu-mir-3068 Mus musculus miR-3068 stem-loop
mmu-miR-3069-5p UUGGCAGUCAAGAUAUUGUUUAGC mmu-mir-3069 Mus musculus miR-3069 stem-loop
mmu-miR-3069-3p UUGGACACUAAGUACUGCCACA mmu-mir-3069 Mus musculus miR-3069 stem-loop
mmu-miR-3070a* AGCCCCUGACCUUGAACCUGGGA mmu-mir-3070a Mus musculus miR-3070a stem-loop
mmu-miR-3070a UGGUGCUACCGUCAGGGGUAGA mmu-mir-3070a Mus musculus miR-3070a stem-loop
mmu-miR-3070b-5p AGCCCCUGACCUUGAACCUGGGA mmu-mir-3070b Mus musculus miR-3070b stem-loop
mmu-miR-3070b-3p UGGUGCUAUGGUCAGGGGUAGA mmu-mir-3070b Mus musculus miR-3070b stem-loop
mmu-miR-3071 ACUCAUUUGAGACGAUGAUGGA mmu-mir-3071 Mus musculus miR-3071 stem-loop
mmu-miR-3071* AUCAUCAAAACAAAUGGAGUCC mmu-mir-3071 Mus musculus miR-3071 stem-loop
mmu-miR-3072* AGGGACCCCGAGGGAGGGCAGG mmu-mir-3072 Mus musculus miR-3072 stem-loop
mmu-miR-3072 UGCCCCCUCCAGGAAGCCUUCU mmu-mir-3072 Mus musculus miR-3072 stem-loop
mmu-miR-3073-5p GUGGUCACAGUUGGCGCCAGCC mmu-mir-3073 Mus musculus miR-3073 stem-loop
mmu-miR-3073-3p UUGAUGUCCACUGUGACCAUAG mmu-mir-3073 Mus musculus miR-3073 stem-loop
mmu-miR-3074-5p GUUCCUGCUGAACUGAGCCAGU mmu-mir-3074-1 Mus musculus miR-3074-1 stem-loop
mmu-mir-3074-2 Mus musculus miR-3074-2 stem-loop
mmu-miR-3074-1-3p GAUAUCAGCUCAGUAGGCACCG mmu-mir-3074-1 Mus musculus miR-3074-1 stem-loop
mmu-miR-3074-2-3p UGUUUCAGCUCAGUAGGCAC mmu-mir-3074-2 Mus musculus miR-3074-2 stem-loop
mmu-miR-3075 UGUCUGGGAGCAGCCAAGGAC mmu-mir-3075 Mus musculus miR-3075 stem-loop
mmu-miR-3075* AUCCUUGGCCUUCCUAGGUGU mmu-mir-3075 Mus musculus miR-3075 stem-loop
mmu-miR-3076-5p CACAGGGGAAGCUCAGUGCCAGCC mmu-mir-3076 Mus musculus miR-3076 stem-loop
mmu-miR-3076-3p CGCACUCUGGUCUUCCCUUGCAG mmu-mir-3076 Mus musculus miR-3076 stem-loop
mmu-miR-3077* CUGCGGACGGGUGGGCGGGCAGGCC mmu-mir-3077 Mus musculus miR-3077 stem-loop
mmu-miR-3077 CUGACUCCCUGCUUCUCCGCAG mmu-mir-3077 Mus musculus miR-3077 stem-loop
mmu-miR-3078 CAAAGCCUAGACUGCAGCUACCU mmu-mir-3078 Mus musculus miR-3078 stem-loop
mmu-miR-3078* UUGCUGGGGUAGUCUUUAGG mmu-mir-3078 Mus musculus miR-3078 stem-loop
mmu-miR-3079-5p UUUGAUCUGAUGAGCUAAGCUGG mmu-mir-3079 Mus musculus miR-3079 stem-loop
mmu-miR-3079-3p CAGGCUCAUCAGAUGAAAGUC mmu-mir-3079 Mus musculus miR-3079 stem-loop
mmu-miR-3080-5p UGAAGCGCCUGUUCUUGGAU mmu-mir-3080 Mus musculus miR-3080 stem-loop
mmu-miR-3080-3p UCCUCGGGCAAAGCGCUUGACA mmu-mir-3080 Mus musculus miR-3080 stem-loop
mmu-miR-3081* GACUGGAGCUUGGAGCGGUGAGC mmu-mir-3081 Mus musculus miR-3081 stem-loop
mmu-miR-3081 UUGCGCUCCGAUCUCUGAGCUGG mmu-mir-3081 Mus musculus miR-3081 stem-loop
mmu-miR-3082-5p GACAGAGUGUGUGUGUCUGUGU mmu-mir-3082 Mus musculus miR-3082 stem-loop
mmu-miR-3082-3p CACAUGGCACUCAACUCUGCAG mmu-mir-3082 Mus musculus miR-3082 stem-loop
mmu-miR-3083 AGGCUGGGAAUAUUUCAGAGAU mmu-mir-3083 Mus musculus miR-3083 stem-loop
mmu-miR-3083* UCCGAAACAUUCCCAGCCUUUA mmu-mir-3083 Mus musculus miR-3083 stem-loop
mmu-miR-3084* GUUGAAGGUUAAUUAGCAGAGU mmu-mir-3084 Mus musculus miR-3084 stem-loop
mmu-miR-3084 UUCUGCCAGUCUCCUUCAGAC mmu-mir-3084 Mus musculus miR-3084 stem-loop
mmu-miR-3085-5p AGGUGCCAUUCCGAGGGCCAAGAGU mmu-mir-3085 Mus musculus miR-3085 stem-loop
mmu-miR-3085-3p UCUGGCUGCUAUGGCCCCCUC mmu-mir-3085 Mus musculus miR-3085 stem-loop
mmu-miR-3086-5p UAGAUUGUAGGCCCAUUGGA mmu-mir-3086 Mus musculus miR-3086 stem-loop
mmu-miR-3086-3p CCCAAUGAGCCUACAGUCUAAG mmu-mir-3086 Mus musculus miR-3086 stem-loop
mmu-miR-3087* CAGGGCAGGGCAAGAGUUGAG mmu-mir-3087 Mus musculus miR-3087 stem-loop
mmu-miR-3087 UAACUCACUGUCAUGUCCUCA mmu-mir-3087 Mus musculus miR-3087 stem-loop
mmu-miR-3088* GCUAUGCAGUUGUUCAUGAGCU mmu-mir-3088 Mus musculus miR-3088 stem-loop
mmu-miR-3088 UUCAUGAGCAGCUGCAAAGGUGU mmu-mir-3088 Mus musculus miR-3088 stem-loop
mmu-miR-3089-5p UGAGUUCAGGGACAGCGUGUCU mmu-mir-3089 Mus musculus miR-3089 stem-loop
mmu-miR-3089-3p AGCAUCUGCUGAUCCUGAGCUGU mmu-mir-3089 Mus musculus miR-3089 stem-loop
mmu-miR-3090* GUCUGGGUGGGGCCUGAGAUC mmu-mir-3090 Mus musculus miR-3090 stem-loop
mmu-miR-3090 UCCCAGGUGACACCCUGACUCA mmu-mir-3090 Mus musculus miR-3090 stem-loop
mmu-miR-3091-5p CAUGGGUCUGGUUGGGCCCGC mmu-mir-3091 Mus musculus miR-3091 stem-loop
mmu-miR-3091-3p CGGGCCUGACCAGUCUCAAGAC mmu-mir-3091 Mus musculus miR-3091 stem-loop
mmu-miR-3092* AGGGGAAAAUGCCUUUCUCCCA mmu-mir-3092 Mus musculus miR-3092 stem-loop
mmu-miR-3092 GAAUGGGGCUGUUUCCCCUCC mmu-mir-3092 Mus musculus miR-3092 stem-loop
mmu-miR-3093-5p CGCACCCCGCGGAGCUCACACU mmu-mir-3093 Mus musculus miR-3093 stem-loop
mmu-miR-3093-3p UGUGGACACCGUGGGAGGUUGG mmu-mir-3093 Mus musculus miR-3093 stem-loop
mmu-miR-3094 UGUUGGGGACAUUUUUAAAGC mmu-mir-3094 Mus musculus miR-3094 stem-loop
mmu-miR-3094* CCUUUAAAUUGUGUCCUCAAG mmu-mir-3094 Mus musculus miR-3094 stem-loop
mmu-miR-3095-5p AAGCUUUCUCAUCUGUGACACU mmu-mir-3095 Mus musculus miR-3095 stem-loop
mmu-miR-3095-3p UGGACACUGGAGAGAGAGCUUUU mmu-mir-3095 Mus musculus miR-3095 stem-loop
mmu-miR-3096-5p UGGCCAAGGAUGAGAACU mmu-mir-3096 Mus musculus miR-3096 stem-loop
mmu-miR-3096-3p UGGGUUAAAGGAUUUACCUGAGGCCA mmu-mir-3096 Mus musculus miR-3096 stem-loop
mmu-miR-3097-5p CACAGGUGGGAAGUGUGUGUCCA mmu-mir-3097 Mus musculus miR-3097 stem-loop
mmu-miR-3097-3p CUCAGACCUUUCUACCUGUCAG mmu-mir-3097 Mus musculus miR-3097 stem-loop
mmu-miR-3098-5p UCCUAACAGCAGGAGUAGGAGC mmu-mir-3098 Mus musculus miR-3098 stem-loop
mmu-miR-3098-3p UUCUGCUGCCUGCCUUUAGGA mmu-mir-3098 Mus musculus miR-3098 stem-loop
mmu-miR-3099* CCAGCUUCCUUCCAGCCCUUG mmu-mir-3099 Mus musculus miR-3099 stem-loop
mmu-miR-3099 UAGGCUAGAGAGAGGUUGGGGA mmu-mir-3099 Mus musculus miR-3099 stem-loop
mmu-miR-30a UGUAAACAUCCUCGACUGGAAG mmu-mir-30a Mus musculus miR-30a stem-loop
mmu-miR-30a* CUUUCAGUCGGAUGUUUGCAGC mmu-mir-30a Mus musculus miR-30a stem-loop
mmu-miR-30b UGUAAACAUCCUACACUCAGCU mmu-mir-30b Mus musculus miR-30b stem-loop
mmu-miR-30b* CUGGGAUGUGGAUGUUUACGUC mmu-mir-30b Mus musculus miR-30b stem-loop
mmu-miR-30c UGUAAACAUCCUACACUCUCAGC mmu-mir-30c-1 Mus musculus miR-30c-1 stem-loop
mmu-mir-30c-2 Mus musculus miR-30c-2 stem-loop
mmu-miR-30c-1* CUGGGAGAGGGUUGUUUACUCC mmu-mir-30c-1 Mus musculus miR-30c-1 stem-loop
mmu-miR-30c-2* CUGGGAGAAGGCUGUUUACUCU mmu-mir-30c-2 Mus musculus miR-30c-2 stem-loop
mmu-miR-30d UGUAAACAUCCCCGACUGGAAG mmu-mir-30d Mus musculus miR-30d stem-loop
mmu-miR-30d* CUUUCAGUCAGAUGUUUGCUGC mmu-mir-30d Mus musculus miR-30d stem-loop
mmu-miR-30e UGUAAACAUCCUUGACUGGAAG mmu-mir-30e Mus musculus miR-30e stem-loop
mmu-miR-30e* CUUUCAGUCGGAUGUUUACAGC mmu-mir-30e Mus musculus miR-30e stem-loop
mmu-miR-31 AGGCAAGAUGCUGGCAUAGCUG mmu-mir-31 Mus musculus miR-31 stem-loop
mmu-miR-31* UGCUAUGCCAACAUAUUGCCAUC mmu-mir-31 Mus musculus miR-31 stem-loop
mmu-miR-3100-5p UUGGGAACGGGGUGUCUUUGGGA mmu-mir-3100 Mus musculus miR-3100 stem-loop
mmu-miR-3100-3p CUGUGACACACCCGCUCCCAG mmu-mir-3100 Mus musculus miR-3100 stem-loop
mmu-miR-3101 GGUACCAUUGACUAAAGCUAG mmu-mir-3101 Mus musculus miR-3101 stem-loop
mmu-miR-3101* UAGCUUUGGUGGAUGGUCUUU mmu-mir-3101 Mus musculus miR-3101 stem-loop
mmu-miR-3102* GUGAGUGGCCAGGGUGGGGCUG mmu-mir-3102 Mus musculus miR-3102 stem-loop
mmu-miR-3102-5p.2 GGUGGUGCAGGCAGGAGAGCC mmu-mir-3102 Mus musculus miR-3102 stem-loop
mmu-miR-3102-3p.2 CUCUACUCCCUGCCCCAGCCA mmu-mir-3102 Mus musculus miR-3102 stem-loop
mmu-miR-3102 GAGCACCCCAUUGGCUACCCACA mmu-mir-3102 Mus musculus miR-3102 stem-loop
mmu-miR-3103* GGAGGGAGGAUCUGCUGUUAG mmu-mir-3103 Mus musculus miR-3103 stem-loop
mmu-miR-3103 UAACCUCUGAUCCUUCCCACAG mmu-mir-3103 Mus musculus miR-3103 stem-loop
mmu-miR-3104-5p UAGGGGGCAGGAGCCGGAGCCCUCU mmu-mir-3104 Mus musculus miR-3104 stem-loop
mmu-miR-3104-3p ACGCUCUGCUUUGCUCCCCCAGA mmu-mir-3104 Mus musculus miR-3104 stem-loop
mmu-miR-3105-5p AGAGCAAGCCCGUAAGCAGCGU mmu-mir-3105 Mus musculus miR-3105 stem-loop
mmu-miR-3105-3p ACUGCUUAUGAGCUUGCACUCC mmu-mir-3105 Mus musculus miR-3105 stem-loop
mmu-miR-3106 UGGCUCAUUUAGAAGCAGCCA mmu-mir-3106 Mus musculus miR-3106 stem-loop
mmu-miR-3106* GCUGCCUAUACAUGGGCUUUCC mmu-mir-3106 Mus musculus miR-3106 stem-loop
mmu-miR-3107 UCCUGUACUGAGCUGCCCCGAG mmu-mir-3107 Mus musculus miR-3107 stem-loop
mmu-miR-3107* CGGGGCAGCUCAGUACAGGA mmu-mir-3107 Mus musculus miR-3107 stem-loop
mmu-miR-3108 GUCUCUAAAGCUAGACGUUCCGG mmu-mir-3108 Mus musculus miR-3108 stem-loop
mmu-miR-3108* CGUCUAGGUCUAGAGUCUCAA mmu-mir-3108 Mus musculus miR-3108 stem-loop
mmu-miR-3109* AAUGGAUGCGAUGGUUCCCAUGCU mmu-mir-3109 Mus musculus miR-3109 stem-loop
mmu-miR-3109 UAGGGCCAUCUCAUCCAGAUA mmu-mir-3109 Mus musculus miR-3109 stem-loop
mmu-miR-3110 UUCUGCCUCCCCUGAAGGCUC mmu-mir-3110 Mus musculus miR-3110 stem-loop
mmu-miR-3110* GCACUCCAUCGGAGGCAGACAC mmu-mir-3110 Mus musculus miR-3110 stem-loop
mmu-miR-3112 ACAUAGAAAAGGCAGUCUGCA mmu-mir-3112 Mus musculus miR-3112 stem-loop
mmu-miR-3112* CAGUUUGUCUCUUCUUUGUCU mmu-mir-3112 Mus musculus miR-3112 stem-loop
mmu-miR-3113 GUCCUGGCCCUGGUCCGGGUCC mmu-mir-3113 Mus musculus miR-3113 stem-loop
mmu-miR-3113* UCCUGGCCCUGGUCCUGGUC mmu-mir-3113 Mus musculus miR-3113 stem-loop
mmu-miR-32 UAUUGCACAUUACUAAGUUGCA mmu-mir-32 Mus musculus miR-32 stem-loop
mmu-miR-32* CAAUUUAGUGUGUGUGAUAUU mmu-mir-32 Mus musculus miR-32 stem-loop
mmu-miR-320* GCCUUCUCUUCCCGGUUCUUCC mmu-mir-320 Mus musculus miR-320 stem-loop
mmu-miR-320 AAAAGCUGGGUUGAGAGGGCGA mmu-mir-320 Mus musculus miR-320 stem-loop
mmu-miR-322 CAGCAGCAAUUCAUGUUUUGGA mmu-mir-322 Mus musculus miR-322 stem-loop
mmu-miR-322* AAACAUGAAGCGCUGCAACAC mmu-mir-322 Mus musculus miR-322 stem-loop
mmu-miR-323-5p AGGUGGUCCGUGGCGCGUUCGC mmu-mir-323 Mus musculus miR-323 stem-loop
mmu-miR-323-3p CACAUUACACGGUCGACCUCU mmu-mir-323 Mus musculus miR-323 stem-loop
mmu-miR-324-5p CGCAUCCCCUAGGGCAUUGGUGU mmu-mir-324 Mus musculus miR-324 stem-loop
mmu-miR-324-3p CCACUGCCCCAGGUGCUGCU mmu-mir-324 Mus musculus miR-324 stem-loop
mmu-miR-325* CCUAGUAGGUGCUCAGUAAGUGU mmu-mir-325 Mus musculus miR-325 stem-loop
mmu-miR-325 UUUAUUGAGCACCUCCUAUCAA mmu-mir-325 Mus musculus miR-325 stem-loop
mmu-miR-326* GGGGGCAGGGCCUUUGUGAAGGCG mmu-mir-326 Mus musculus miR-326 stem-loop
mmu-miR-326 CCUCUGGGCCCUUCCUCCAGU mmu-mir-326 Mus musculus miR-326 stem-loop
mmu-miR-327 ACUUGAGGGGCAUGAGGAU mmu-mir-327 Mus musculus miR-327 stem-loop
mmu-miR-328* GGGGGGCAGGAGGGGCUCAGGG mmu-mir-328 Mus musculus miR-328 stem-loop
mmu-miR-328 CUGGCCCUCUCUGCCCUUCCGU mmu-mir-328 Mus musculus miR-328 stem-loop
mmu-miR-329* AGAGGUUUUCUGGGUCUCUGUU mmu-mir-329 Mus musculus miR-329 stem-loop
mmu-miR-329 AACACACCCAGCUAACCUUUUU mmu-mir-329 Mus musculus miR-329 stem-loop
mmu-miR-33 GUGCAUUGUAGUUGCAUUGCA mmu-mir-33 Mus musculus miR-33 stem-loop
mmu-miR-33* CAAUGUUUCCACAGUGCAUCAC mmu-mir-33 Mus musculus miR-33 stem-loop
mmu-miR-330 UCUCUGGGCCUGUGUCUUAGGC mmu-mir-330 Mus musculus miR-330 stem-loop
mmu-miR-330* GCAAAGCACAGGGCCUGCAGAGA mmu-mir-330 Mus musculus miR-330 stem-loop
mmu-miR-331-5p CUAGGUAUGGUCCCAGGGAUCC mmu-mir-331 Mus musculus miR-331 stem-loop
mmu-miR-331-3p GCCCCUGGGCCUAUCCUAGAA mmu-mir-331 Mus musculus miR-331 stem-loop
mmu-miR-335-5p UCAAGAGCAAUAACGAAAAAUGU mmu-mir-335 Mus musculus miR-335 stem-loop
mmu-miR-335-3p UUUUUCAUUAUUGCUCCUGACC mmu-mir-335 Mus musculus miR-335 stem-loop
mmu-miR-337-5p GAACGGCGUCAUGCAGGAGUU mmu-mir-337 Mus musculus miR-337 stem-loop
mmu-miR-337-3p UUCAGCUCCUAUAUGAUGCCU mmu-mir-337 Mus musculus miR-337 stem-loop
mmu-miR-338-5p AACAAUAUCCUGGUGCUGAGUG mmu-mir-338 Mus musculus miR-338 stem-loop
mmu-miR-338-3p UCCAGCAUCAGUGAUUUUGUUG mmu-mir-338 Mus musculus miR-338 stem-loop
mmu-miR-339-5p UCCCUGUCCUCCAGGAGCUCACG mmu-mir-339 Mus musculus miR-339 stem-loop
mmu-miR-339-3p UGAGCGCCUCGGCGACAGAGCCG mmu-mir-339 Mus musculus miR-339 stem-loop
mmu-miR-340-5p UUAUAAAGCAAUGAGACUGAUU mmu-mir-340 Mus musculus miR-340 stem-loop
mmu-miR-340-3p UCCGUCUCAGUUACUUUAUAGC mmu-mir-340 Mus musculus miR-340 stem-loop
mmu-miR-341* CGGUCGGCCGAUCGCUCGGUC mmu-mir-341 Mus musculus miR-341 stem-loop
mmu-miR-341 UCGGUCGAUCGGUCGGUCGGU mmu-mir-341 Mus musculus miR-341 stem-loop
mmu-miR-342-5p AGGGGUGCUAUCUGUGAUUGAG mmu-mir-342 Mus musculus miR-342 stem-loop
mmu-miR-342-3p UCUCACACAGAAAUCGCACCCGU mmu-mir-342 Mus musculus miR-342 stem-loop
mmu-miR-343 UCUCCCUUCAUGUGCCCAGA mmu-mir-343 Mus musculus miR-343 stem-loop
mmu-miR-344* AGUCAGGCUCCUGGCUAGAUUCCAGG mmu-mir-344-1 Mus musculus miR-344-1 stem-loop
mmu-mir-344-2 Mus musculus miR-344-2 stem-loop
mmu-miR-344 UGAUCUAGCCAAAGCCUGACUGU mmu-mir-344-1 Mus musculus miR-344-1 stem-loop
mmu-mir-344-2 Mus musculus miR-344-2 stem-loop
mmu-miR-344b* AGUCAGGCUCCUGGCUAAAGUUC mmu-mir-344b Mus musculus miR-344b stem-loop
mmu-miR-344b CAUUUAGCCAAAGCCUGACUGU mmu-mir-344b Mus musculus miR-344b stem-loop
mmu-miR-344c* AGUCAGGCUGCUGGCUAGAGUAC mmu-mir-344c Mus musculus miR-344c stem-loop
mmu-miR-344c UGAUCUAGUCAAAGCCUGACAGU mmu-mir-344c Mus musculus miR-344c stem-loop
mmu-miR-344d-1* AGUCAGGCUGCUGGCUAUACACCA mmu-mir-344d-1 Mus musculus miR-344d-1 stem-loop
mmu-miR-344d GAUAUAACCACUGCCAGACUGA mmu-mir-344d-1 Mus musculus miR-344d-1 stem-loop
mmu-mir-344d-2 Mus musculus miR-344d-2 stem-loop
mmu-mir-344d-3 Mus musculus miR-344d-3 stem-loop
mmu-miR-344d-2* AGUCUGGUUGCUGGCUAUAUUCCA mmu-mir-344d-2 Mus musculus miR-344d-2 stem-loop
mmu-miR-344d-3* AGUCAGGCUAGUGGUUAUACUCC mmu-mir-344d-3 Mus musculus miR-344d-3 stem-loop
mmu-miR-344e* CAGGCUUCUGGCUAUAUUCC mmu-mir-344e Mus musculus miR-344e stem-loop
mmu-miR-344e GAUAUAACCAAAGCCUGACUAU mmu-mir-344e Mus musculus miR-344e stem-loop
mmu-miR-344f-5p AGUCAGUCUCCUGGCUGGAGUC mmu-mir-344f Mus musculus miR-344f stem-loop
mmu-miR-344f-3p CUCUAGCCAGGACCUGACUAC mmu-mir-344f Mus musculus miR-344f stem-loop
mmu-miR-344g-5p AGUCAGGCUCCUGGCAGGAGU mmu-mir-344g Mus musculus miR-344g stem-loop
mmu-miR-344g-3p CAGGCUCUAGCCAGGGGCUUGA mmu-mir-344g Mus musculus miR-344g stem-loop
mmu-miR-345-5p GCUGACCCCUAGUCCAGUGCUU mmu-mir-345 Mus musculus miR-345 stem-loop
mmu-miR-345-3p CCUGAACUAGGGGUCUGGAGAC mmu-mir-345 Mus musculus miR-345 stem-loop
mmu-miR-346 UGUCUGCCCGAGUGCCUGCCUCU mmu-mir-346 Mus musculus miR-346 stem-loop
mmu-miR-346* AGGCAGGGGCUGGGCCUGCAGC mmu-mir-346 Mus musculus miR-346 stem-loop
mmu-miR-3470a UCACUUUGUAGACCAGGCUGG mmu-mir-3470a Mus musculus miR-3470a stem-loop
mmu-miR-3470b UCACUCUGUAGACCAGGCUGG mmu-mir-3470b Mus musculus miR-3470b stem-loop
mmu-miR-3471 UGAGAUCCAACUGUAAGGCAUU mmu-mir-3471-1 Mus musculus miR-3471-1 stem-loop
mmu-mir-3471-2 Mus musculus miR-3471-2 stem-loop
mmu-miR-3472 UAAUAGCCAGAAGCUGGAAGGAACC mmu-mir-3472 Mus musculus miR-3472 stem-loop
mmu-miR-3473 UGGAGAGAUGGCUCAGCA mmu-mir-3473 Mus musculus miR-3473 stem-loop
mmu-miR-3474 CCCUGGGAGGAGACGUGGAUUC mmu-mir-3474 Mus musculus miR-3474 stem-loop
mmu-miR-3475 UCUGGAGGCACAUGGUUUGAA mmu-mir-3475 Mus musculus miR-3475 stem-loop
mmu-miR-34a UGGCAGUGUCUUAGCUGGUUGU mmu-mir-34a Mus musculus miR-34a stem-loop
mmu-miR-34a* AAUCAGCAAGUAUACUGCCCU mmu-mir-34a Mus musculus miR-34a stem-loop
mmu-miR-34b-5p AGGCAGUGUAAUUAGCUGAUUGU mmu-mir-34b Mus musculus miR-34b stem-loop
mmu-miR-34b-3p AAUCACUAACUCCACUGCCAUC mmu-mir-34b Mus musculus miR-34b stem-loop
mmu-miR-34c AGGCAGUGUAGUUAGCUGAUUGC mmu-mir-34c Mus musculus miR-34c stem-loop
mmu-miR-34c* AAUCACUAACCACACAGCCAGG mmu-mir-34c Mus musculus miR-34c stem-loop
mmu-miR-350* AAAGUGCAUGCGCUUUGGG mmu-mir-350 Mus musculus miR-350 stem-loop
mmu-miR-350 UUCACAAAGCCCAUACACUUUC mmu-mir-350 Mus musculus miR-350 stem-loop
mmu-miR-351 UCCCUGAGGAGCCCUUUGAGCCUG mmu-mir-351 Mus musculus miR-351 stem-loop
mmu-miR-351* GGUCAAGAGGCGCCUGGGAAC mmu-mir-351 Mus musculus miR-351 stem-loop
mmu-miR-361 UUAUCAGAAUCUCCAGGGGUAC mmu-mir-361 Mus musculus miR-361 stem-loop
mmu-miR-361* UCCCCCAGGUGUGAUUCUGAUUUGU mmu-mir-361 Mus musculus miR-361 stem-loop
mmu-miR-362-5p AAUCCUUGGAACCUAGGUGUGAAU mmu-mir-362 Mus musculus miR-362 stem-loop
mmu-miR-362-3p AACACACCUGUUCAAGGAUUCA mmu-mir-362 Mus musculus miR-362 stem-loop
mmu-miR-363-5p CAGGUGGAACACGAUGCAAUUU mmu-mir-363 Mus musculus miR-363 stem-loop
mmu-miR-363-3p AAUUGCACGGUAUCCAUCUGUA mmu-mir-363 Mus musculus miR-363 stem-loop
mmu-miR-365-1* AGGGACUUUUGGGGGCAGAUGUG mmu-mir-365-1 Mus musculus miR-365-1 stem-loop
mmu-miR-365 UAAUGCCCCUAAAAAUCCUUAU mmu-mir-365-1 Mus musculus miR-365-1 stem-loop
mmu-mir-365-2 Mus musculus miR-365-2 stem-loop
mmu-miR-365-2* AGGGACUUUCAGGGGCAGCUGUG mmu-mir-365-2 Mus musculus miR-365-2 stem-loop
mmu-miR-367* ACUGUUGCUAACAUGCAACUC mmu-mir-367 Mus musculus miR-367 stem-loop
mmu-miR-367 AAUUGCACUUUAGCAAUGGUGA mmu-mir-367 Mus musculus miR-367 stem-loop
mmu-miR-369-5p AGAUCGACCGUGUUAUAUUCGC mmu-mir-369 Mus musculus miR-369 stem-loop
mmu-miR-369-3p AAUAAUACAUGGUUGAUCUUU mmu-mir-369 Mus musculus miR-369 stem-loop
mmu-miR-370* CAGGUCACGUCUCUGCAGUU mmu-mir-370 Mus musculus miR-370 stem-loop
mmu-miR-370 GCCUGCUGGGGUGGAACCUGGU mmu-mir-370 Mus musculus miR-370 stem-loop
mmu-miR-374 AUAUAAUACAACCUGCUAAGUG mmu-mir-374 Mus musculus mir-374 stem-loop
mmu-miR-374* GGUUGUAUUAUCAUUGUCCGAG mmu-mir-374 Mus musculus mir-374 stem-loop
mmu-miR-374c AUAAUACAACCUGCUAAGUG mmu-mir-374c Mus musculus miR-374c stem-loop
mmu-miR-374c* ACUUAGCAGGUUGUAUUAU mmu-mir-374c Mus musculus miR-374c stem-loop
mmu-miR-375* GCGACGAGCCCCUCGCACAAAC mmu-mir-375 Mus musculus miR-375 stem-loop
mmu-miR-375 UUUGUUCGUUCGGCUCGCGUGA mmu-mir-375 Mus musculus miR-375 stem-loop
mmu-miR-376a* GGUAGAUUCUCCUUCUAUGAGU mmu-mir-376a Mus musculus miR-376a stem-loop
mmu-miR-376a AUCGUAGAGGAAAAUCCACGU mmu-mir-376a Mus musculus miR-376a stem-loop
mmu-miR-376b* GUGGAUAUUCCUUCUAUGGUUA mmu-mir-376b Mus musculus miR-376b stem-loop
mmu-miR-376b AUCAUAGAGGAACAUCCACUU mmu-mir-376b Mus musculus miR-376b stem-loop
mmu-miR-376c* GUGGAUAUUCCUUCUAUGUUUA mmu-mir-376c Mus musculus miR-376c stem-loop
mmu-miR-376c AACAUAGAGGAAAUUUCACGU mmu-mir-376c Mus musculus miR-376c stem-loop
mmu-miR-377* AGAGGUUGCCCUUGGUGAAUUC mmu-mir-377 Mus musculus miR-377 stem-loop
mmu-miR-377 AUCACACAAAGGCAACUUUUGU mmu-mir-377 Mus musculus miR-377 stem-loop
mmu-miR-378* CUCCUGACUCCAGGUCCUGUGU mmu-mir-378 Mus musculus miR-378 stem-loop
mmu-miR-378 ACUGGACUUGGAGUCAGAAGG mmu-mir-378 Mus musculus miR-378 stem-loop
mmu-miR-379 UGGUAGACUAUGGAACGUAGG mmu-mir-379 Mus musculus miR-379 stem-loop
mmu-miR-379* UAUGUAACAUGGUCCACUAACU mmu-mir-379 Mus musculus miR-379 stem-loop
mmu-miR-380-5p AUGGUUGACCAUAGAACAUGCG mmu-mir-380 Mus musculus miR-380 stem-loop
mmu-miR-380-3p UAUGUAGUAUGGUCCACAUCUU mmu-mir-380 Mus musculus miR-380 stem-loop
mmu-miR-381* AGCGAGGUUGCCCUUUGUAUAUU mmu-mir-381 Mus musculus miR-381 stem-loop
mmu-miR-381 UAUACAAGGGCAAGCUCUCUGU mmu-mir-381 Mus musculus miR-381 stem-loop
mmu-miR-382 GAAGUUGUUCGUGGUGGAUUCG mmu-mir-382 Mus musculus miR-382 stem-loop
mmu-miR-382* UCAUUCACGGACAACACUUUUU mmu-mir-382 Mus musculus miR-382 stem-loop
mmu-miR-383 AGAUCAGAAGGUGACUGUGGCU mmu-mir-383 Mus musculus miR-383 stem-loop
mmu-miR-383* CCACAGCACUGCCUGGUCAGA mmu-mir-383 Mus musculus miR-383 stem-loop
mmu-miR-384-5p UGUAAACAAUUCCUAGGCAAUGU mmu-mir-384 Mus musculus miR-384 stem-loop
mmu-miR-384-3p AUUCCUAGAAAUUGUUCACAAU mmu-mir-384 Mus musculus miR-384 stem-loop
mmu-miR-409-5p AGGUUACCCGAGCAACUUUGCAU mmu-mir-409 Mus musculus miR-409 stem-loop
mmu-miR-409-3p GAAUGUUGCUCGGUGAACCCCU mmu-mir-409 Mus musculus miR-409 stem-loop
mmu-miR-410* AGGUUGUCUGUGAUGAGUUCG mmu-mir-410 Mus musculus miR-410 stem-loop
mmu-miR-410 AAUAUAACACAGAUGGCCUGU mmu-mir-410 Mus musculus miR-410 stem-loop
mmu-miR-411 UAGUAGACCGUAUAGCGUACG mmu-mir-411 Mus musculus miR-411 stem-loop
mmu-miR-411* UAUGUAACACGGUCCACUAACC mmu-mir-411 Mus musculus miR-411 stem-loop
mmu-miR-412-5p UGGUCGACCAGCUGGAAAGUAAU mmu-mir-412 Mus musculus miR-412 stem-loop
mmu-miR-412-3p UUCACCUGGUCCACUAGCCG mmu-mir-412 Mus musculus miR-412 stem-loop
mmu-miR-421* CUCAUUAAAUGUUUGUUGAAU mmu-mir-421 Mus musculus miR-421 stem-loop
mmu-miR-421 AUCAACAGACAUUAAUUGGGCGC mmu-mir-421 Mus musculus miR-421 stem-loop
mmu-miR-423-5p UGAGGGGCAGAGAGCGAGACUUU mmu-mir-423 Mus musculus miR-423 stem-loop
mmu-miR-423-3p AGCUCGGUCUGAGGCCCCUCAGU mmu-mir-423 Mus musculus miR-423 stem-loop
mmu-miR-425 AAUGACACGAUCACUCCCGUUGA mmu-mir-425 Mus musculus miR-425 stem-loop
mmu-miR-425* AUCGGGAAUGUCGUGUCCGCC mmu-mir-425 Mus musculus miR-425 stem-loop
mmu-miR-429* GUCUUACCAGACAUGGUUAGA mmu-mir-429 Mus musculus miR-429 stem-loop
mmu-miR-429 UAAUACUGUCUGGUAAUGCCGU mmu-mir-429 Mus musculus miR-429 stem-loop
mmu-miR-431 UGUCUUGCAGGCCGUCAUGCA mmu-mir-431 Mus musculus miR-431 stem-loop
mmu-miR-431* CAGGUCGUCUUGCAGGGCUUCU mmu-mir-431 Mus musculus miR-431 stem-loop
mmu-miR-432 UCUUGGAGUAGAUCAGUGGGCAG mmu-mir-432 Mus musculus miR-432 stem-loop
mmu-miR-433* UACGGUGAGCCUGUCAUUAUUC mmu-mir-433 Mus musculus miR-433 stem-loop
mmu-miR-433 AUCAUGAUGGGCUCCUCGGUGU mmu-mir-433 Mus musculus miR-433 stem-loop
mmu-miR-434-5p GCUCGACUCAUGGUUUGAACCA mmu-mir-434 Mus musculus miR-434 stem-loop
mmu-miR-434-3p UUUGAACCAUCACUCGACUCCU mmu-mir-434 Mus musculus miR-434 stem-loop
mmu-miR-448-5p GAACAUCCUGCAUAGUGCUGCC mmu-mir-448 Mus musculus miR-448 stem-loop
mmu-miR-448-3p UUGCAUAUGUAGGAUGUCCCAU mmu-mir-448 Mus musculus miR-448 stem-loop
mmu-miR-449a UGGCAGUGUAUUGUUAGCUGGU mmu-mir-449a Mus musculus miR-449a stem-loop
mmu-miR-449a* CAGCUAACAUGCGACUGCUCUC mmu-mir-449a Mus musculus miR-449a stem-loop
mmu-miR-449b AGGCAGUGUUGUUAGCUGGC mmu-mir-449b Mus musculus miR-449b stem-loop
mmu-miR-449c AGGCAGUGCAUUGCUAGCUGG mmu-mir-449c Mus musculus miR-449c stem-loop
mmu-miR-450a UUUUGCGAUGUGUUCCUAAUAU mmu-mir-450a-1 Mus musculus miR-450a-1 stem-loop
mmu-mir-450a-2 Mus musculus miR-450a-2 stem-loop
mmu-miR-450a-1* AUUGGGAACAUUUUGCAUAAAU mmu-mir-450a-1 Mus musculus miR-450a-1 stem-loop
mmu-miR-450a-2* AUUGGGGAUGCUUUGCAUUCAU mmu-mir-450a-2 Mus musculus miR-450a-2 stem-loop
mmu-miR-450b-5p UUUUGCAGUAUGUUCCUGAAUA mmu-mir-450b Mus musculus miR-450b stem-loop
mmu-miR-450b-3p AUUGGGAACAUUUUGCAUGCAU mmu-mir-450b Mus musculus miR-450b stem-loop
mmu-miR-451 AAACCGUUACCAUUACUGAGUU mmu-mir-451 Mus musculus miR-451 stem-loop
mmu-miR-452-5p UGUUUGCAGAGGAAACUGAGAC mmu-mir-452 Mus musculus miR-452 stem-loop
mmu-miR-452-3p UCAGUCUCAUCUGCAAAGAGGU mmu-mir-452 Mus musculus miR-452 stem-loop
mmu-miR-453 AGGUUGCCUCAUAGUGAGCUUGCA mmu-mir-453 Mus musculus miR-453 stem-loop
mmu-miR-455* UAUGUGCCUUUGGACUACAUCG mmu-mir-455 Mus musculus miR-455 stem-loop
mmu-miR-455 GCAGUCCACGGGCAUAUACAC mmu-mir-455 Mus musculus miR-455 stem-loop
mmu-miR-463* UACCUAAUUUGUUGUCCAUCAU mmu-mir-463 Mus musculus miR-463 stem-loop
mmu-miR-463 UGAUAGACACCAUAUAAGGUAG mmu-mir-463 Mus musculus miR-463 stem-loop
mmu-miR-464 UACCAAGUUUAUUCUGUGAGAUA mmu-mir-464 Mus musculus miR-464 stem-loop
mmu-miR-465a-5p UAUUUAGAAUGGCACUGAUGUGA mmu-mir-465a Mus musculus miR-465a stem-loop
mmu-miR-465a-3p GAUCAGGGCCUUUCUAAGUAGA mmu-mir-465a Mus musculus miR-465a stem-loop
mmu-miR-465b-5p UAUUUAGAAUGGUGCUGAUCUG mmu-mir-465b-1 Mus musculus miR-465b-1 stem-loop
mmu-mir-465b-2 Mus musculus miR-465b-2 stem-loop
mmu-miR-465b-3p GAUCAGGGCCUUUCUAAGUAGA mmu-mir-465b-1 Mus musculus miR-465b-1 stem-loop
mmu-mir-465b-2 Mus musculus miR-465b-2 stem-loop
mmu-miR-465c-5p UAUUUAGAAUGGCGCUGAUCUG mmu-mir-465c-1 Mus musculus miR-465c-1 stem-loop
mmu-mir-465c-2 Mus musculus miR-465c-2 stem-loop
mmu-miR-465c-3p GAUCAGGGCCUUUCUAAGUAGA mmu-mir-465c-1 Mus musculus miR-465c-1 stem-loop
mmu-mir-465c-2 Mus musculus miR-465c-2 stem-loop
mmu-miR-466a-5p UAUGUGUGUGUACAUGUACAUA mmu-mir-466a Mus musculus miR-466a stem-loop
mmu-miR-466a-3p UAUACAUACACGCACACAUAAGA mmu-mir-466a Mus musculus miR-466a stem-loop
mmu-miR-466b-5p UGAUGUGUGUGUACAUGUACAU mmu-mir-466b-1 Mus musculus miR-466b-1 stem-loop
mmu-mir-466b-2 Mus musculus miR-466b-2 stem-loop
mmu-mir-466b-3 Mus musculus miR-466b-3 stem-loop
mmu-mir-466b-4 Mus musculus miR-466b-4 stem-loop
mmu-mir-466b-5 Mus musculus miR-466b-5 stem-loop
mmu-mir-466b-6 Mus musculus miR-466b-6 stem-loop
mmu-mir-466b-7 Mus musculus miR-466b-7 stem-loop
mmu-mir-466b-8 Mus musculus miR-466b-8 stem-loop
mmu-miR-466b-3p AUACAUACACGCACACAUAAGA mmu-mir-466b-1 Mus musculus miR-466b-1 stem-loop
mmu-mir-466b-2 Mus musculus miR-466b-2 stem-loop
mmu-mir-466b-3 Mus musculus miR-466b-3 stem-loop
mmu-mir-466b-4 Mus musculus miR-466b-4 stem-loop
mmu-mir-466b-5 Mus musculus miR-466b-5 stem-loop
mmu-mir-466b-6 Mus musculus miR-466b-6 stem-loop
mmu-mir-466b-7 Mus musculus miR-466b-7 stem-loop
mmu-mir-466b-8 Mus musculus miR-466b-8 stem-loop
mmu-miR-466c-5p UGAUGUGUGUGUGCAUGUACAUAU mmu-mir-466c-1 Mus musculus miR-466c-1 stem-loop
mmu-mir-466c-2 Mus musculus miR-466c-2 stem-loop
mmu-miR-466c-3p AUACAUACACGCACACAUAAGA mmu-mir-466c-1 Mus musculus miR-466c-1 stem-loop
mmu-mir-466c-2 Mus musculus miR-466c-2 stem-loop
mmu-miR-466d-5p UGUGUGUGCGUACAUGUACAUG mmu-mir-466d Mus musculus miR-466d stem-loop
mmu-miR-466d-3p UAUACAUACACGCACACAUAG mmu-mir-466d Mus musculus miR-466d stem-loop
mmu-miR-466e-5p GAUGUGUGUGUACAUGUACAUA mmu-mir-466e Mus musculus miR-466e stem-loop
mmu-miR-466e-3p UAUACAUACACGCACACAUAAGA mmu-mir-466e Mus musculus miR-466e stem-loop
mmu-miR-466f-5p UACGUGUGUGUGCAUGUGCAUG mmu-mir-466f-1 Mus musculus miR-466f-1 stem-loop
mmu-mir-466f-2 Mus musculus miR-466f-2 stem-loop
mmu-mir-466f-3 Mus musculus miR-466f-3 stem-loop
mmu-miR-466f-3p CAUACACACACACAUACACAC mmu-mir-466f-1 Mus musculus miR-466f-1 stem-loop
mmu-mir-466f-2 Mus musculus miR-466f-2 stem-loop
mmu-mir-466f-3 Mus musculus miR-466f-3 stem-loop
mmu-miR-466f ACGUGUGUGUGCAUGUGCAUGU mmu-mir-466f-4 Mus musculus miR-466f-4 stem-loop
mmu-miR-466g AUACAGACACAUGCACACACA mmu-mir-466g Mus musculus miR-466g stem-loop
mmu-miR-466h-5p UGUGUGCAUGUGCUUGUGUGUA mmu-mir-466h Mus musculus miR-466h stem-loop
mmu-miR-466h-3p UACGCACGCACACACACAC mmu-mir-466h Mus musculus miR-466h stem-loop
mmu-miR-466i-5p UGUGUGUGUGUGUGUGUGUG mmu-mir-466i Mus musculus miR-466i stem-loop
mmu-miR-466i-3p AUACACACACACAUACACACUA mmu-mir-466i Mus musculus miR-466i stem-loop
mmu-miR-466j UGUGUGCAUGUGCAUGUGUGUAA mmu-mir-466j Mus musculus miR-466j stem-loop
mmu-miR-466k UGUGUGUGUACAUGUACAUGUGA mmu-mir-466k Mus musculus miR-466k stem-loop
mmu-miR-466l-5p UUGUGUGUACAUGUACAUGUAU mmu-mir-466l Mus musculus miR-466l stem-loop
mmu-miR-466l-3p UAUAAAUACAUGCACACAUAUU mmu-mir-466l Mus musculus miR-466l stem-loop
mmu-miR-466m-5p UGUGUGCAUGUGCAUGUGUGUAU mmu-mir-466m Mus musculus miR-466m stem-loop
mmu-miR-466m-3p UACAUACACACAUACACACGCA mmu-mir-466m Mus musculus miR-466m stem-loop
mmu-miR-466n-5p GUGUGUGCGUACAUGUACAUGU mmu-mir-466n Mus musculus miR-466n stem-loop
mmu-miR-466n-3p UAUACAUGAGAGCAUACAUAGA mmu-mir-466n Mus musculus miR-466n stem-loop
mmu-miR-466o-5p UGAUGUGUGUGUACAUGUACAU mmu-mir-466o Mus musculus miR-466o stem-loop
mmu-miR-466o-3p UACAUACAUGCACACAUAAGAC mmu-mir-466o Mus musculus miR-466o stem-loop
mmu-miR-466p-5p UAUGUGUGUGUACAUGUACAU mmu-mir-466p Mus musculus miR-466p stem-loop
mmu-miR-466p-3p AUACAUACACGCACACAUAAGA mmu-mir-466p Mus musculus miR-466p stem-loop
mmu-miR-467a UAAGUGCCUGCAUGUAUAUGCG mmu-mir-467a-1 Mus musculus miR-467a-1 stem-loop
mmu-mir-467a-10 Mus musculus miR-467a-10 stem-loop
mmu-mir-467a-2 Mus musculus miR-467a-2 stem-loop
mmu-mir-467a-3 Mus musculus miR-467a-3 stem-loop
mmu-mir-467a-4 Mus musculus miR-467a-4 stem-loop
mmu-mir-467a-5 Mus musculus miR-467a-5 stem-loop
mmu-mir-467a-6 Mus musculus miR-467a-6 stem-loop
mmu-mir-467a-7 Mus musculus miR-467a-7 stem-loop
mmu-mir-467a-8 Mus musculus miR-467a-8 stem-loop
mmu-mir-467a-9 Mus musculus miR-467a-9 stem-loop
mmu-miR-467a* CAUAUACAUACACACACCUACA mmu-mir-467a-1 Mus musculus miR-467a-1 stem-loop
mmu-mir-467a-10 Mus musculus miR-467a-10 stem-loop
mmu-mir-467a-2 Mus musculus miR-467a-2 stem-loop
mmu-mir-467a-3 Mus musculus miR-467a-3 stem-loop
mmu-mir-467a-4 Mus musculus miR-467a-4 stem-loop
mmu-mir-467a-5 Mus musculus miR-467a-5 stem-loop
mmu-mir-467a-6 Mus musculus miR-467a-6 stem-loop
mmu-mir-467a-7 Mus musculus miR-467a-7 stem-loop
mmu-mir-467a-8 Mus musculus miR-467a-8 stem-loop
mmu-mir-467a-9 Mus musculus miR-467a-9 stem-loop
mmu-miR-467b GUAAGUGCCUGCAUGUAUAUG mmu-mir-467b Mus musculus miR-467b stem-loop
mmu-miR-467b* AUAUACAUACACACACCAACAC mmu-mir-467b Mus musculus miR-467b stem-loop
mmu-miR-467c UAAGUGCGUGCAUGUAUAUGUG mmu-mir-467c Mus musculus miR-467c stem-loop
mmu-miR-467c* AUAUACAUACACACACCUAUAC mmu-mir-467c Mus musculus miR-467c stem-loop
mmu-miR-467d UAAGUGCGCGCAUGUAUAUGCG mmu-mir-467d Mus musculus miR-467d stem-loop
mmu-miR-467d* AUAUACAUACACACACCUACAC mmu-mir-467d Mus musculus miR-467d stem-loop
mmu-miR-467e AUAAGUGUGAGCAUGUAUAUGU mmu-mir-467e Mus musculus miR-467e stem-loop
mmu-miR-467e* AUAUACAUACACACACCUAUAU mmu-mir-467e Mus musculus miR-467e stem-loop
mmu-miR-467f AUAUACACACACACACCUACA mmu-mir-467f Mus musculus miR-467f stem-loop
mmu-miR-467g UAUACAUACACACACAUAUAU mmu-mir-467g Mus musculus miR-467g stem-loop
mmu-miR-467h AUAAGUGUGUGCAUGUAUAUGU mmu-mir-467h Mus musculus miR-467h stem-loop
mmu-miR-468 UAUGACUGAUGUGCGUGUGUCUG mmu-mir-468 Mus musculus miR-468 stem-loop
mmu-miR-469 UGCCUCUUUCAUUGAUCUUGGUGUCC mmu-mir-469 Mus musculus miR-469 stem-loop
mmu-miR-470 UUCUUGGACUGGCACUGGUGAGU mmu-mir-470 Mus musculus miR-470 stem-loop
mmu-miR-470* AACCAGUACCUUUCUGAGAAGA mmu-mir-470 Mus musculus miR-470 stem-loop
mmu-miR-471-5p UACGUAGUAUAGUGCUUUUCAC mmu-mir-471 Mus musculus miR-471 stem-loop
mmu-miR-471-3p UGAAAGGUGCCAUACUAUGUAU mmu-mir-471 Mus musculus miR-471 stem-loop
mmu-miR-483 AAGACGGGAGAAGAGAAGGGAG mmu-mir-483 Mus musculus miR-483 stem-loop
mmu-miR-483* UCACUCCUCCCCUCCCGUCUU mmu-mir-483 Mus musculus miR-483 stem-loop
mmu-miR-484 UCAGGCUCAGUCCCCUCCCGAU mmu-mir-484 Mus musculus miR-484 stem-loop
mmu-miR-485 AGAGGCUGGCCGUGAUGAAUUC mmu-mir-485 Mus musculus miR-485 stem-loop
mmu-miR-485* AGUCAUACACGGCUCUCCUCUC mmu-mir-485 Mus musculus miR-485 stem-loop
mmu-miR-486 UCCUGUACUGAGCUGCCCCGAG mmu-mir-486 Mus musculus miR-486 stem-loop
mmu-miR-486* CGGGGCAGCUCAGUACAGGAU mmu-mir-486 Mus musculus miR-486 stem-loop
mmu-miR-487b* UGGUUAUCCCUGUCCUCUUCG mmu-mir-487b Mus musculus miR-487b stem-loop
mmu-miR-487b AAUCGUACAGGGUCAUCCACUU mmu-mir-487b Mus musculus miR-487b stem-loop
mmu-miR-488* CCCAGAUAAUAGCACUCUCAA mmu-mir-488 Mus musculus miR-488 stem-loop
mmu-miR-488 UUGAAAGGCUGUUUCUUGGUC mmu-mir-488 Mus musculus miR-488 stem-loop
mmu-miR-489 AAUGACACCACAUAUAUGGCAGC mmu-mir-489 Mus musculus miR-489 stem-loop
mmu-miR-490-5p CCAUGGAUCUCCAGGUGGGU mmu-mir-490 Mus musculus miR-490 stem-loop
mmu-miR-490-3p CAACCUGGAGGACUCCAUGCUG mmu-mir-490 Mus musculus miR-490 stem-loop
mmu-miR-491 AGUGGGGAACCCUUCCAUGAGG mmu-mir-491 Mus musculus miR-491 stem-loop
mmu-miR-491* CUUAUGCAAGAUUCCCUUCUAC mmu-mir-491 Mus musculus miR-491 stem-loop
mmu-miR-493* UUGUACAUGGUAGGCUUUC mmu-mir-493 Mus musculus miR-493 stem-loop
mmu-miR-493 UGAAGGUCCUACUGUGUGCCAGG mmu-mir-493 Mus musculus miR-493 stem-loop
mmu-miR-494* AGGUUGUCCGUGUUGUCUUCUC mmu-mir-494 Mus musculus miR-494 stem-loop
mmu-miR-494 UGAAACAUACACGGGAAACCUC mmu-mir-494 Mus musculus miR-494 stem-loop
mmu-miR-495* GAAGUUGCCCAUGUUAUUUUUCG mmu-mir-495 Mus musculus miR-495 stem-loop
mmu-miR-495 AAACAAACAUGGUGCACUUCUU mmu-mir-495 Mus musculus miR-495 stem-loop
mmu-miR-496* AGGUUGCCCAUGGUGUGUUCA mmu-mir-496 Mus musculus mir-496 stem-loop
mmu-miR-496 UGAGUAUUACAUGGCCAAUCUC mmu-mir-496 Mus musculus mir-496 stem-loop
mmu-miR-497 CAGCAGCACACUGUGGUUUGUA mmu-mir-497 Mus musculus miR-497 stem-loop
mmu-miR-497* CAAACCACACUGUGGUGUUAG mmu-mir-497 Mus musculus miR-497 stem-loop
mmu-miR-499 UUAAGACUUGCAGUGAUGUUU mmu-mir-499 Mus musculus miR-499 stem-loop
mmu-miR-499* GAACAUCACAGCAAGUCUGUGCU mmu-mir-499 Mus musculus miR-499 stem-loop
mmu-miR-500* AAUCCUUGCUAUCUGGGUGCUUAGU mmu-mir-500 Mus musculus miR-500 stem-loop
mmu-miR-500 AAUGCACCUGGGCAAGGGUUCA mmu-mir-500 Mus musculus miR-500 stem-loop
mmu-miR-501-5p AAUCCUUUGUCCCUGGGUGAAA mmu-mir-501 Mus musculus miR-501 stem-loop
mmu-miR-501-3p AAUGCACCCGGGCAAGGAUUUG mmu-mir-501 Mus musculus miR-501 stem-loop
mmu-miR-503 UAGCAGCGGGAACAGUACUGCAG mmu-mir-503 Mus musculus miR-503 stem-loop
mmu-miR-503* GAGUAUUGUUUCCACUGCCUGG mmu-mir-503 Mus musculus miR-503 stem-loop
mmu-miR-504 AGACCCUGGUCUGCACUCUAUC mmu-mir-504 Mus musculus miR-504 stem-loop
mmu-miR-504* AGGGAGAGCAGGGCAGGGUUUC mmu-mir-504 Mus musculus miR-504 stem-loop
mmu-miR-505-5p GGGAGCCAGGAAGUAUUGAUGUU mmu-mir-505 Mus musculus miR-505 stem-loop
mmu-miR-505-3p CGUCAACACUUGCUGGUUUUCU mmu-mir-505 Mus musculus miR-505 stem-loop
mmu-miR-509-5p UACUCCAGAAUGUGGCAAUCAU mmu-mir-509 Mus musculus miR-509 stem-loop
mmu-miR-509-3p UGAUUGACAUUUCUGUAAUGG mmu-mir-509 Mus musculus miR-509 stem-loop
mmu-miR-511-5p AUGCCUUUUGCUCUGCACUCA mmu-mir-511 Mus musculus miR-511 stem-loop
mmu-miR-511-3p AAUGUGUAGCAAAAGACAGGAU mmu-mir-511 Mus musculus miR-511 stem-loop
mmu-miR-532-5p CAUGCCUUGAGUGUAGGACCGU mmu-mir-532 Mus musculus miR-532 stem-loop
mmu-miR-532-3p CCUCCCACACCCAAGGCUUGCA mmu-mir-532 Mus musculus miR-532 stem-loop
mmu-miR-539-5p GGAGAAAUUAUCCUUGGUGUGU mmu-mir-539 Mus musculus miR-539 stem-loop
mmu-miR-539-3p CAUACAAGGAUAAUUUCUUUUU mmu-mir-539 Mus musculus miR-539 stem-loop
mmu-miR-540-5p CAAGGGUCACCCUCUGACUCUGU mmu-mir-540 Mus musculus miR-540 stem-loop
mmu-miR-540-3p AGGUCAGAGGUCGAUCCUGG mmu-mir-540 Mus musculus miR-540 stem-loop
mmu-miR-541 AAGGGAUUCUGAUGUUGGUCACACU mmu-mir-541 Mus musculus miR-541 stem-loop
mmu-miR-541* UGGCGAACACAGAAUCCAUACU mmu-mir-541 Mus musculus miR-541 stem-loop
mmu-miR-542-5p CUCGGGGAUCAUCAUGUCACGA mmu-mir-542 Mus musculus miR-542 stem-loop
mmu-miR-542-3p UGUGACAGAUUGAUAACUGAAA mmu-mir-542 Mus musculus miR-542 stem-loop
mmu-miR-543* AAGUUGCCCGCGUGUUUUUCG mmu-mir-543 Mus musculus miR-543 stem-loop
mmu-miR-543 AAACAUUCGCGGUGCACUUCUU mmu-mir-543 Mus musculus miR-543 stem-loop
mmu-miR-544-5p UCUUGUUAAAAAGCAGAGUCU mmu-mir-544 Mus musculus miR-544 stem-loop
mmu-miR-544-3p AUUCUGCAUUUUUAGCAAGCUC mmu-mir-544 Mus musculus miR-544 stem-loop
mmu-miR-546 AUGGUGGCACGGAGUC mmu-mir-546 Mus musculus miR-546 stem-loop
mmu-miR-547* CACUUGAGGAUGUACCACCCA mmu-mir-547 Mus musculus miR-547 stem-loop
mmu-miR-547 CUUGGUACAUCUUUGAGUGAG mmu-mir-547 Mus musculus miR-547 stem-loop
mmu-miR-551b* GAAAUCAAGCUUGGGUGAGACCU mmu-mir-551b Mus musculus mir-551b stem-loop
mmu-miR-551b GCGACCCAUACUUGGUUUCAG mmu-mir-551b Mus musculus mir-551b stem-loop
mmu-miR-568 AUGUAUAAAUGUAUACACAC mmu-mir-568 Mus musculus miR-568 stem-loop
mmu-miR-574-5p UGAGUGUGUGUGUGUGAGUGUGU mmu-mir-574 Mus musculus miR-574 stem-loop
mmu-miR-574-3p CACGCUCAUGCACACACCCACA mmu-mir-574 Mus musculus miR-574 stem-loop
mmu-miR-582-5p UACAGUUGUUCAACCAGUUACU mmu-mir-582 Mus musculus miR-582 stem-loop
mmu-miR-582-3p CCUGUUGAACAACUGAACCCAA mmu-mir-582 Mus musculus miR-582 stem-loop
mmu-miR-590-5p GAGCUUAUUCAUAAAAGUGCAG mmu-mir-590 Mus musculus miR-590 stem-loop
mmu-miR-590-3p UAAUUUUAUGUAUAAGCUAGU mmu-mir-590 Mus musculus miR-590 stem-loop
mmu-miR-592 AUUGUGUCAAUAUGCGAUGAUGU mmu-mir-592 Mus musculus mir-592 stem-loop
mmu-miR-592* UCAUCACGUGGUGACGCAACAU mmu-mir-592 Mus musculus mir-592 stem-loop
mmu-miR-598* GCGGUGAUGCCGAUGGUGCGAGC mmu-mir-598 Mus musculus miR-598 stem-loop
mmu-miR-598 UACGUCAUCGUCGUCAUCGUUA mmu-mir-598 Mus musculus miR-598 stem-loop
mmu-miR-599 UUGUGUCAGUUUAUCAAAC mmu-mir-599 Mus musculus miR-599 stem-loop
mmu-miR-615-5p GGGGGUCCCCGGUGCUCGGAUC mmu-mir-615 Mus musculus miR-615 stem-loop
mmu-miR-615-3p UCCGAGCCUGGGUCUCCCUCUU mmu-mir-615 Mus musculus miR-615 stem-loop
mmu-miR-652* CAACCCUAGGAGGGGGUGCCAUUC mmu-mir-652 Mus musculus miR-652 stem-loop
mmu-miR-652 AAUGGCGCCACUAGGGUUGUG mmu-mir-652 Mus musculus miR-652 stem-loop
mmu-miR-653 GUGUUGAAACAAUCUCUACUG mmu-mir-653 Mus musculus miR-653 stem-loop
mmu-miR-653* UUCACUGGAGUUUGUUUCAGU mmu-mir-653 Mus musculus miR-653 stem-loop
mmu-miR-654-5p UGGUAAGCUGCAGAACAUGUGU mmu-mir-654 Mus musculus miR-654 stem-loop
mmu-miR-654-3p UAUGUCUGCUGACCAUCACCUU mmu-mir-654 Mus musculus miR-654 stem-loop
mmu-miR-664* CUGGCUGGGGAAAAUGACUGG mmu-mir-664 Mus musculus miR-664 stem-loop
mmu-miR-664 UAUUCAUUUACUCCCCAGCCUA mmu-mir-664 Mus musculus miR-664 stem-loop
mmu-miR-665* AGGGGCCUCUGCCUCUAUCCAGGAUU mmu-mir-665 Mus musculus mir-665 stem-loop
mmu-miR-665 ACCAGGAGGCUGAGGUCCCU mmu-mir-665 Mus musculus mir-665 stem-loop
mmu-miR-666-5p AGCGGGCACAGCUGUGAGAGCC mmu-mir-666 Mus musculus mir-666 stem-loop
mmu-miR-666-3p GGCUGCAGCGUGAUCGCCUGCU mmu-mir-666 Mus musculus mir-666 stem-loop
mmu-miR-667* CGGUGCUGGUGGAGCAGUGAGCACG mmu-mir-667 Mus musculus mir-667 stem-loop
mmu-miR-667 UGACACCUGCCACCCAGCCCAAG mmu-mir-667 Mus musculus mir-667 stem-loop
mmu-miR-668* GUAAGUGUGCCUCGGGUGAGCAUG mmu-mir-668 Mus musculus mir-668 stem-loop
mmu-miR-668 UGUCACUCGGCUCGGCCCACUACC mmu-mir-668 Mus musculus mir-668 stem-loop
mmu-miR-669a-5p AGUUGUGUGUGCAUGUUCAUGUCU mmu-mir-669a-1 Mus musculus mir-669a-1 stem-loop
mmu-mir-669a-10 Mus musculus miR-669a-10 stem-loop
mmu-mir-669a-11 Mus musculus miR-669a-11 stem-loop
mmu-mir-669a-12 Mus musculus miR-669a-12 stem-loop
mmu-mir-669a-2 Mus musculus miR-669a-2 stem-loop
mmu-mir-669a-3 Mus musculus miR-669a-3 stem-loop
mmu-mir-669a-4 Mus musculus miR-669a-4 stem-loop
mmu-mir-669a-5 Mus musculus miR-669a-5 stem-loop
mmu-mir-669a-6 Mus musculus miR-669a-6 stem-loop
mmu-mir-669a-7 Mus musculus miR-669a-7 stem-loop
mmu-mir-669a-8 Mus musculus miR-669a-8 stem-loop
mmu-mir-669a-9 Mus musculus miR-669a-9 stem-loop
mmu-miR-669a-3p ACAUAACAUACACACACACGUAU mmu-mir-669a-1 Mus musculus mir-669a-1 stem-loop
mmu-mir-669a-10 Mus musculus miR-669a-10 stem-loop
mmu-mir-669a-11 Mus musculus miR-669a-11 stem-loop
mmu-mir-669a-12 Mus musculus miR-669a-12 stem-loop
mmu-mir-669a-2 Mus musculus miR-669a-2 stem-loop
mmu-mir-669a-4 Mus musculus miR-669a-4 stem-loop
mmu-mir-669a-5 Mus musculus miR-669a-5 stem-loop
mmu-mir-669a-6 Mus musculus miR-669a-6 stem-loop
mmu-mir-669a-7 Mus musculus miR-669a-7 stem-loop
mmu-mir-669a-8 Mus musculus miR-669a-8 stem-loop
mmu-mir-669a-9 Mus musculus miR-669a-9 stem-loop
mmu-miR-669a-3-3p ACAUAACAUACACACACAUGUAU mmu-mir-669a-3 Mus musculus miR-669a-3 stem-loop
mmu-miR-669b AGUUUUGUGUGCAUGUGCAUGU mmu-mir-669b Mus musculus miR-669b stem-loop
mmu-miR-669b* CAUAUACAUACACACAAACAUAU mmu-mir-669b Mus musculus miR-669b stem-loop
mmu-miR-669c AUAGUUGUGUGUGGAUGUGUGU mmu-mir-669c Mus musculus miR-669c stem-loop
mmu-miR-669c* UACACACACACACACAAGUAAA mmu-mir-669c Mus musculus miR-669c stem-loop
mmu-miR-669d ACUUGUGUGUGCAUGUAUAUGU mmu-mir-669d Mus musculus miR-669d stem-loop
mmu-mir-669d-2 Mus musculus miR-669d-2 stem-loop
mmu-miR-669d* UAUACAUACACACCCAUAUAC mmu-mir-669d Mus musculus miR-669d stem-loop
mmu-miR-669d-2* AUAUACAUACACACCCAUAUAC mmu-mir-669d-2 Mus musculus miR-669d-2 stem-loop
mmu-miR-669e UGUCUUGUGUGUGCAUGUUCAU mmu-mir-669e Mus musculus miR-669e stem-loop
mmu-miR-669e* UGAAUAUACACACACUUACAC mmu-mir-669e Mus musculus miR-669e stem-loop
mmu-miR-669f-5p AGUUGUGUGUGCAUGUGCAUGUGU mmu-mir-669f Mus musculus miR-669f stem-loop
mmu-miR-669f-3p CAUAUACAUACACACACACGUAU mmu-mir-669f Mus musculus miR-669f stem-loop
mmu-miR-669g UGCAUUGUAUGUGUUGACAUGAU mmu-mir-669g Mus musculus miR-669g stem-loop
mmu-miR-669h-5p AUGCAUGGGUGUAUAGUUGAGUGC mmu-mir-669h Mus musculus miR-669h stem-loop
mmu-miR-669h-3p UAUGCAUAUACACACAUGCACA mmu-mir-669h Mus musculus miR-669h stem-loop
mmu-miR-669i UGCAUAUACACACAUGCAUAC mmu-mir-669i Mus musculus miR-669i stem-loop
mmu-miR-669j UGCAUAUACUCACAUGCAAACA mmu-mir-669j Mus musculus miR-669j stem-loop
mmu-miR-669k* UGUGCAUGUGUGUAUAGUUGUGUGC mmu-mir-669k Mus musculus miR-669k stem-loop
mmu-miR-669k UAUGCAUAUACACGCAUGCAA mmu-mir-669k Mus musculus miR-669k stem-loop
mmu-miR-669l AGUUGUGUGUGCAUGUAUAUGU mmu-mir-669l Mus musculus miR-669l stem-loop
mmu-miR-669l* AUAUACAUACACACCCAUAUAU mmu-mir-669l Mus musculus miR-669l stem-loop
mmu-miR-669m-5p UGUGUGCAUGUGCAUGUGUGUAU mmu-mir-669m-1 Mus musculus miR-669m stem-loop
mmu-mir-669m-2 Mus musculus miR-669n stem-loop
mmu-miR-669m-3p AUAUACAUCCACACAAACAUAU mmu-mir-669m-1 Mus musculus miR-669m stem-loop
mmu-mir-669m-2 Mus musculus miR-669n stem-loop
mmu-miR-669n AUUUGUGUGUGGAUGUGUGU mmu-mir-669n Mus musculus miR-669n stem-loop
mmu-miR-669o-5p UAGUUGUGUGUGCAUGUUUAUGU mmu-mir-669o Mus musculus miR-669o stem-loop
mmu-miR-669o-3p ACAUAACAUACACACACACGUAU mmu-mir-669o Mus musculus miR-669o stem-loop
mmu-miR-669p AGUUGUGUGUGCAUGUUCAUGUCU mmu-mir-669p-1 Mus musculus miR-669p-1 stem-loop
mmu-mir-669p-2 Mus musculus miR-669p-2 stem-loop
mmu-miR-669p* CAUAACAUACACACACACACGUAU mmu-mir-669p-1 Mus musculus miR-669p-1 stem-loop
mmu-mir-669p-2 Mus musculus miR-669p-2 stem-loop
mmu-miR-670 AUCCCUGAGUGUAUGUGGUGAA mmu-mir-670 Mus musculus mir-670 stem-loop
mmu-miR-670* UUUCCUCAUAUCCAUUCAGGAGUGU mmu-mir-670 Mus musculus mir-670 stem-loop
mmu-miR-671-5p AGGAAGCCCUGGAGGGGCUGGAG mmu-mir-671 Mus musculus mir-671 stem-loop
mmu-miR-671-3p UCCGGUUCUCAGGGCUCCACC mmu-mir-671 Mus musculus mir-671 stem-loop
mmu-miR-672 UGAGGUUGGUGUACUGUGUGUGA mmu-mir-672 Mus musculus mir-672 stem-loop
mmu-miR-672* ACACACAGUCACUAUCUUCGA mmu-mir-672 Mus musculus mir-672 stem-loop
mmu-miR-673-5p CUCACAGCUCUGGUCCUUGGAG mmu-mir-673 Mus musculus mir-673 stem-loop
mmu-miR-673-3p UCCGGGGCUGAGUUCUGUGCACC mmu-mir-673 Mus musculus mir-673 stem-loop
mmu-miR-674 GCACUGAGAUGGGAGUGGUGUA mmu-mir-674 Mus musculus mir-674 stem-loop
mmu-miR-674* CACAGCUCCCAUCUCAGAACAA mmu-mir-674 Mus musculus mir-674 stem-loop
mmu-miR-675-5p UGGUGCGGAAAGGGCCCACAGU mmu-mir-675 Mus musculus mir-675 stem-loop
mmu-miR-675-3p CUGUAUGCCCUAACCGCUCAGU mmu-mir-675 Mus musculus mir-675 stem-loop
mmu-miR-676* ACUCUACAACCUUAGGACUUGC mmu-mir-676 Mus musculus miR-676 stem-loop
mmu-miR-676 CCGUCCUGAGGUUGUUGAGCU mmu-mir-676 Mus musculus miR-676 stem-loop
mmu-miR-677 UUCAGUGAUGAUUAGCUUCUGA mmu-mir-677 Mus musculus miR-677 stem-loop
mmu-miR-677* GAAGCCAGAUGCCGUUCCUGAGAAGG mmu-mir-677 Mus musculus miR-677 stem-loop
mmu-miR-678 GUCUCGGUGCAAGGACUGGAGG mmu-mir-678 Mus musculus miR-678 stem-loop
mmu-miR-679-5p GGACUGUGAGGUGACUCUUGGU mmu-mir-679 Mus musculus miR-679 stem-loop
mmu-miR-679-3p AGCAAGGUCCUCCUCACAGUAG mmu-mir-679 Mus musculus miR-679 stem-loop
mmu-miR-680 GGGCAUCUGCUGACAUGGGGG mmu-mir-680-1 Mus musculus miR-680-1 stem-loop
mmu-mir-680-2 Mus musculus miR-680-2 stem-loop
mmu-mir-680-3 Mus musculus miR-680-3 stem-loop
mmu-miR-681 CAGCCUCGCUGGCAGGCAGCU mmu-mir-681 Mus musculus miR-681 stem-loop
mmu-miR-682 CUGCAGUCACAGUGAAGUCUG mmu-mir-682 Mus musculus miR-682 stem-loop
mmu-miR-683 CCUGCUGUAAGCUGUGUCCUC mmu-mir-683-1 Mus musculus miR-683-1 stem-loop
mmu-mir-683-2 Mus musculus miR-683-2 stem-loop
mmu-miR-684 AGUUUUCCCUUCAAGUCAA mmu-mir-684-1 Mus musculus miR-684-1 stem-loop
mmu-mir-684-2 Mus musculus miR-684-2 stem-loop
mmu-miR-686 AUUGCUUCCCAGACGGUGAAGA mmu-mir-686 Mus musculus miR-686 stem-loop
mmu-miR-687 CUAUCCUGGAAUGCAGCAAUGA mmu-mir-687 Mus musculus miR-687 stem-loop
mmu-miR-688 UCGCAGGCGACUACUUAUUC mmu-mir-688 Mus musculus miR-688 stem-loop
mmu-miR-690 AAAGGCUAGGCUCACAACCAAA mmu-mir-690 Mus musculus miR-690 stem-loop
mmu-miR-691 AUUCCUGAAGAGAGGCAGAAAA mmu-mir-691 Mus musculus miR-691 stem-loop
mmu-miR-692 AUCUCUUUGAGCGCCUCACUC mmu-mir-692-1 Mus musculus miR-692-1 stem-loop
mmu-mir-692-2 Mus musculus miR-692-2 stem-loop
mmu-miR-693-5p CAGCCACAUCCGAAAGUUUUC mmu-mir-693 Mus musculus miR-693 stem-loop
mmu-miR-693-3p GCAGCUUUCAGAUGUGGCUGUAA mmu-mir-693 Mus musculus miR-693 stem-loop
mmu-miR-694 CUGAAAAUGUUGCCUGAAG mmu-mir-694 Mus musculus miR-694 stem-loop
mmu-miR-695 AGAUUGGGCAUAGGUGACUGAA mmu-mir-695 Mus musculus miR-695 stem-loop
mmu-miR-696 GCGUGUGCUUGCUGUGGG mmu-mir-696 Mus musculus miR-696 stem-loop
mmu-miR-697 AACAUCCUGGUCCUGUGGAGA mmu-mir-697 Mus musculus miR-697 stem-loop
mmu-miR-698 CAUUCUCGUUUCCUUCCCU mmu-mir-698 Mus musculus miR-698 stem-loop
mmu-miR-700* UAAGGCUCCUUCCUGUGCUUGC mmu-mir-700 Mus musculus miR-700 stem-loop
mmu-miR-700 CACGCGGGAACCGAGUCCACC mmu-mir-700 Mus musculus miR-700 stem-loop
mmu-miR-701 UUAGCCGCUGAAAUAGAUGGA mmu-mir-701 Mus musculus miR-701 stem-loop
mmu-miR-701* UAUCUAUUAAAGAGGCUAGC mmu-mir-701 Mus musculus miR-701 stem-loop
mmu-miR-702 UGCCCACCCUUUACCCCGCUC mmu-mir-702 Mus musculus miR-702 stem-loop
mmu-miR-703 AAAACCUUCAGAAGGAAAGAA mmu-mir-703 Mus musculus miR-703 stem-loop
mmu-miR-704 AGACAUGUGCUCUGCUCCUAG mmu-mir-704 Mus musculus miR-704 stem-loop
mmu-miR-705 GGUGGGAGGUGGGGUGGGCA mmu-mir-705 Mus musculus miR-705 stem-loop