A Regulatory RNA Motifs and Elements Finder
  Release 1.0, Jan 2006

Regulatory Motif Classes
Regulatory RNA Motifs in UTR
Exonic Splicing Regulatory Motifs
Intronic Splicing Regulatory Motifs
Transcriptional Regulatory RNA Motifs
Exonic Splicing Regulatory Motifs  176 entries
Accession Name Pattern Binding Protein
R0601 ESE-SPp20 WCWWC SRp20
R0614 ESE-9G8 (GAC)n 9G8
R0621 ESE-SRp40 YRCRKM SRp40
R0623 ESE-TRA2beta (GAA)n TRA2beta
R0624 ESS2 in hnRNA A1 on Tat23 Pre-mRNA Splicing AGAUCCUAGACUAGAGCCU unknown
R0627 ESS-IgM pre-mRNA splicing inhibitor, human CCTGTTGGCACGTGTTTCTCTTCCCCGCCC
U2 snRNP
R0628 ESS- exonic splicing silencer in the testes-specific DNA ligase III beta exon CCAAGUCAAAAUUUAC unknown
R0629 ESS-beta-TM exonic splicing silencer UGUGGG unknown
R0630 ESS of human fibronectin EDA exon, Element A GAAGAAGA unknown
R0631 ESS of human fibronectin EDA exon, Element B CAAGG unknown
R0632 ESS3 in hnRNA A1 on Tat23 Pre-mRNA Splicing AGAUCCAUUCGAUUAGUGAA unknown
R0633 beta-TM exonic splicing silencer UGUGGG unknown
R0634 alpha-TM exonic splicing silencer UAAGUGUUCUGAGCU unknown
R0635 Fibronectin exonic splicing silencer CAAG unknown
R0636 FGF-2R exonic splicing silencer UAAG unknown
R0637 CD44 exonic splicing silencer AGACAGAAUCAGCACCAGUGCUCAUGGAGA
R0801 Exon enhancer GATGAC
R0802 Exon silencer TTAATTTCAAGA SF2/ASF, SRp55, SRp75
R0803 Exon enhancer AGAAAGAAGAAA ASF/SF2, hTra2alpha
R0804 Exon silencer CAAGG
R0805 Exon silencer CATGG
R0806 Exon enhancer GAAGAAGA
R0808 Exon enhancer GAAGAAGAC
R0809 Exon enhancer AGGGTGACC
R0811 Exon enhancer GAAGGACAGCA U2 snRNA
R0814 Exon enhancer GAAGAAGA
R0815 Exon enhancer GGAAG ASF/SF2
R0817 Exon enhancer AAGAAGAGG
R0818 Exon enhancer AAGAAGCGAA
R0819 Exon enhancer GGAAAGAAAAGGGA
R0820 Exon enhancer ACTTCAACAAGTT
R0821 Exon enhancer CTTCAATCAACAT SR proteins, Tra, Tra2
R0822 Exon enhancer CAACAATCAACAT SR proteins, Tra, Tra2
R0823 Exon enhancer TCWWCRATCAACA Tra/Tra2
R0824 Exon enhancer TCWWCRATCAACA Tra/Tra2
R0825 Exon enhancer AAAGGACAAAGGACAAAA Tra/Tra2
R0826 Exon enhancer TGCATG
R0827 Exon enhancer GAGGAAGGTG ASF/SF2,hnRNP A1,H,F
R0829 Exon silencer TAAGTGTTCTGAGCT
R0831 Exon enhancer GAAGAAGAA ASF/SF2
R0832 Exon silencer CTAGACTAGA hnRNP A1
R0833 Exon silencer TTGGGT hnRNP H
R0835 Exon enhancer GAGAAAGGAGAGA ASF/SF2, SC35
R0836 Exon silencer AGATCC
R0837 Exon silencer TTAG
R0839 Exon silencer TTAG hnRNPA1, SC35
R0840 Exon enhancer GARGARGAR ASF/SF2
R0841 Exon enhancer GAGGAGGAG ASF/SF2
R0842 Exon enhancer AAAGAGGAC
R0843 Exon silencer TGTGGGGGAC hnRNP H
R0844 Exon enhancer GAAGAAGAG ASF/SF2
R0846 Exon silencer TAGGGCAGGC
R0847 Exon silencer TAGG hnRNP A1
R0852 Exon enhancer CAACCACAA YB-1
hnRNP A1
R0855 Exon enhancer GGAAGAAGATAAAGAC 9G8, ASF/SF2, SRp20
R0857 Exon silencer MCYYGCAMGCA
R0858 Exon enhancer TTATTTTTCCC PTB
R0859 Exon enhancer GAAGAAGAAG SRp40, 37-kDa protein
R0860 Exon enhancer GCAGCACCTGGC SRp55
R0861 Exon enhancer ACTTCAACAAGTT hTra2 beta
R0864 Exon enhancer GACGACGAG 9G8
R0865 Exon enhancer GATGAAGAG ASF/SF2
R0866 Exon enhancer AAGAAGAAG
R0867 Exon enhancer GCTGAGT SF2/ASF
R0869 Exon enhancer AAGAAGAAG Tra2beta
R0870 Exon enhancer AAGAGGA ASF/SF2
R0871 Exon enhancer TGCCGTT SC35
R0872 Exon enhancer AAAGGACAAA ASF/SF2
R0873 Exon enhancer TGGACCCAGAGGT
R0874 Exon enhancer TGCTGTT SC35
R0875 Exon enhancer GAAGAGGAAG Tra2-alpha
R0878 Exon enhancer AAAGAAGGAAA
R0879 Exon silencer AGTTCCA
R0881 Exon enhancer CACCATTCACGACACC
R0882 Exon enhancer GACCTCAACAATT hTra2 , SRp55
SR protein
R0884 Exon enhancer CAGACAA SF2/ASF
R0885 Exon enhancer AAGAAGGAAGG Htra2‑�1, hnRNP‑G, SRp30c
R0886 Exon enhancer AAGAAAAGGGA hTra2 , SRp55
R0887 Exon silencer TAGACA