RegRNA
A Regulatory RNA Motifs and Elements Finder
  Release 1.0, Jan 2006
 
 
 

Regulatory Motif Classes
 
Regulatory RNA Motifs in UTR
Riboswitches
Exonic Splicing Regulatory Motifs
Intronic Splicing Regulatory Motifs
Transcriptional Regulatory RNA Motifs
miRNA
 
Exonic Splicing Regulatory Motifs  176 entries
Accession Name Pattern Binding Protein
R0601 ESE-SPp20 WCWWC SRp20
R0602 ESE-SPp20 CUCKUCY SRp20
R0603 ESE-SPp20 CCUCGUCC SRp20
R0604 ESE-SPp20 GCUCCUCUUCC SRp20
R0605 ESE-SC35 AGSAGAGUA SC35
R0606 ESE-SC35 GUUCGAGUA SC35
R0607 ESE-SC35 UGUUCSAGWU SC35
R0608 ESE-SC35 GWUWCCUGCUA SC35
R0609 ESE-SC35 GGGUAUGCUG SC35
R0610 ESE-SC35 GAGCAGUAGKS SC35
R0611 ESE-SC35 AGGAGAU SC35
R0612 ESE-SC35 GRYYMCYR SC35
R0613 ESE-SC35 UGCYGYY SC35
R0614 ESE-9G8 (GAC)n 9G8
R0615 ESE-9G8 ACGAGAGAY 9G8
R0616 ESE-9G8 WGGACRA 9G8
R0617 ESE-SF2/ASF RGAAGAAC SF2/ASF
R0618 ESE-SF2/ASF AGGACRRAGC SF2/ASF
R0619 ESE-SF2/ASF CRSMSGW SF2/ASF
R0620 ESE-SRp40 UGGGAGCRGUYRGCUCGY SRp40
R0621 ESE-SRp40 YRCRKM SRp40
R0622 ESE-SRp55 YYWCWCSG SRp55
R0623 ESE-TRA2beta (GAA)n TRA2beta
R0624 ESS2 in hnRNA A1 on Tat23 Pre-mRNA Splicing AGAUCCUAGACUAGAGCCU unknown
R0627 ESS-IgM pre-mRNA splicing inhibitor, human CCTGTTGGCACGTGTTTCTCTTCCCCGCCC
GGCCTCCAGAAGAGAGCTCTCACACAGGCT
TCCTCTCGA
U2 snRNP
R0628 ESS- exonic splicing silencer in the testes-specific DNA ligase III beta exon CCAAGUCAAAAUUUAC unknown
R0629 ESS-beta-TM exonic splicing silencer UGUGGG unknown
R0630 ESS of human fibronectin EDA exon, Element A GAAGAAGA unknown
R0631 ESS of human fibronectin EDA exon, Element B CAAGG unknown
R0632 ESS3 in hnRNA A1 on Tat23 Pre-mRNA Splicing AGAUCCAUUCGAUUAGUGAA unknown
R0633 beta-TM exonic splicing silencer UGUGGG unknown
R0634 alpha-TM exonic splicing silencer UAAGUGUUCUGAGCU unknown
R0635 Fibronectin exonic splicing silencer CAAG unknown
R0636 FGF-2R exonic splicing silencer UAAG unknown
R0637 CD44 exonic splicing silencer AGACAGAAUCAGCACCAGUGCUCAUGGAGA
AAAUUGGACC
unknown
R0801 Exon enhancer GATGAC
R0802 Exon silencer TTAATTTCAAGA SF2/ASF, SRp55, SRp75
R0803 Exon enhancer AGAAAGAAGAAA ASF/SF2, hTra2alpha
R0804 Exon silencer CAAGG
R0805 Exon silencer CATGG
R0806 Exon enhancer GAAGAAGA
R0807 Exon enhancer TACAGGGTGACCTACTCTAGCCCTGA
R0808 Exon enhancer GAAGAAGAC
R0809 Exon enhancer AGGGTGACC
R0810 Exon enhancer GGAAGGACAGCAGAGACCAAGAG U2 snRNA
R0811 Exon enhancer GAAGGACAGCA U2 snRNA
R0812 Exon silencer CTAGTAAACTTATTCTTACGTCTTTCCTGT
GTTGCCCTCCAGCTTTTATCTCTGAGATGG
TCTTCTTTCTAGA
R0813 Exon enhancer AAGAGGAAGAATGGCTTGAGGAAGACGACG SRp55
R0814 Exon enhancer GAAGAAGA
R0815 Exon enhancer GGAAG ASF/SF2
R0816 Exon enhancer TAAAGAAGAGGCCCAACAAAAAGAAGCGAA
AG
R0817 Exon enhancer AAGAAGAGG
R0818 Exon enhancer AAGAAGCGAA
R0819 Exon enhancer GGAAAGAAAAGGGA
R0820 Exon enhancer ACTTCAACAAGTT
R0821 Exon enhancer CTTCAATCAACAT SR proteins, Tra, Tra2
R0822 Exon enhancer CAACAATCAACAT SR proteins, Tra, Tra2
R0823 Exon enhancer TCWWCRATCAACA Tra/Tra2
R0824 Exon enhancer TCWWCRATCAACA Tra/Tra2
R0825 Exon enhancer AAAGGACAAAGGACAAAA Tra/Tra2
R0826 Exon enhancer TGCATG
R0827 Exon enhancer GAGGAAGGTG ASF/SF2,hnRNP A1,H,F
R0828 Exon silencer TAAGTGTTCTGAGCTGGAGGAGGAGCTGAA
GAATGTCACCAACAACCTCAAGTCTCTTGA
GGCTCAGGCGGAGAAG
R0829 Exon silencer TAAGTGTTCTGAGCT
R0830 Exon enhancer CTCCTATGGCAGGAAGAAGCGGAGACAGCG
ACGAAG
ASF/SF2
R0831 Exon enhancer GAAGAAGAA ASF/SF2
R0832 Exon silencer CTAGACTAGA hnRNP A1
R0833 Exon silencer TTGGGT hnRNP H
R0834 Exon silencer AGATCCATTCGATTAGTGAA
R0835 Exon enhancer GAGAAAGGAGAGA ASF/SF2, SC35
R0836 Exon silencer AGATCC
R0837 Exon silencer TTAG
R0838 Exon enhancer GAAGAAGAAGGTGGAGAGAGAGAGACAGAG
R0839 Exon silencer TTAG hnRNPA1, SC35
R0840 Exon enhancer GARGARGAR ASF/SF2
R0841 Exon enhancer GAGGAGGAG ASF/SF2
R0842 Exon enhancer AAAGAGGAC
R0843 Exon silencer TGTGGGGGAC hnRNP H
R0844 Exon enhancer GAAGAAGAG ASF/SF2
R0845 Exon enhancer GAGGAAGAGAAAAGGGCAGCAGAGGAGAGG
CA
R0846 Exon silencer TAGGGCAGGC
R0847 Exon silencer TAGG hnRNP A1
R0848 Exon enhancer CACCCCGGTGACCTGCTGCAGCTTCGCTGT
CGGCTGCGGGACGATGTGCAGAGCATCAAC
TGGCTGCGG
SRp55
R0849 Exon enhancer GACGGGGTGCAGCTGGCGGAAAGCAACCGC
ACCCGCATCACAGGGGAGGAGGTGGAGGTG
CAGGACTCCGTG
SRp55
R0850 Exon silencer TCTTTAGGTTCCCTTTCAATTCT PTB
R0851 Exon enhancer ACAAAGCGTTCTACCAGCAGCCAGATGCTG
R0852 Exon enhancer CAACCACAA YB-1
R0853 Exon silencer AGACAGAATCAGCACCAGTGCTCATGGAGA
AAATTGGACCCCGGAACCACAGCCTCCTTT
CAATAACCAT
hnRNP A1
R0854 Exon enhancer GAGTATCAGGATGAAGAGGAGACCCCACAT
GCTACAAGCA
R0855 Exon enhancer GGAAGAAGATAAAGAC 9G8, ASF/SF2, SRp20
R0856 Exon silencer GTGACCCCTTACCTACTCACACCACTGCAT
TCTCACCCGCAAGCACCTTTG
R0857 Exon silencer MCYYGCAMGCA
R0858 Exon enhancer TTATTTTTCCC PTB
R0859 Exon enhancer GAAGAAGAAG SRp40, 37-kDa protein
R0860 Exon enhancer GCAGCACCTGGC SRp55
R0861 Exon enhancer ACTTCAACAAGTT hTra2 beta
R0862 Exon silencer CGAATCGACAAAGGGGAGGAAGTGGGAGAA
A
HnRNP H
R0863 Exon silencer ATCGAGAAACCAGCAACGGAGCGGCGAATC
GAC
SF2/ASF
R0864 Exon enhancer GACGACGAG 9G8
R0865 Exon enhancer GATGAAGAG ASF/SF2
R0866 Exon enhancer AAGAAGAAG
R0867 Exon enhancer GCTGAGT SF2/ASF
R0868 Exon enhancer AAGAAGAAAAAAGAAGAAA ASF/SF2
R0869 Exon enhancer AAGAAGAAG Tra2beta
R0870 Exon enhancer AAGAGGA ASF/SF2
R0871 Exon enhancer TGCCGTT SC35
R0872 Exon enhancer AAAGGACAAA ASF/SF2
R0873 Exon enhancer TGGACCCAGAGGT
R0874 Exon enhancer TGCTGTT SC35
R0875 Exon enhancer GAAGAGGAAG Tra2-alpha
R0876 Exon enhancer AAGAGATGGGCAAGGAGGTGGA
R0877 Exon enhancer ATCCAGGAGGGGAACAGA ASF/SF2
R0878 Exon enhancer AAAGAAGGAAA
R0879 Exon silencer AGTTCCA
R0880 Exon enhancer AGAGATCGAGGAGGATTTGAGAGNNNNNNN
NNNNNNNNNNNNNNNGAAGAAAGA
R0881 Exon enhancer CACCATTCACGACACC
R0882 Exon enhancer GACCTCAACAATT hTra2 , SRp55
R0883 Exon enhancer GGGGGGAAGCACACAGAGCCCAACGAGACC
AC
SR protein
R0884 Exon enhancer CAGACAA SF2/ASF
R0885 Exon enhancer AAGAAGGAAGG Htra2‑�1, hnRNP‑G, SRp30c
R0886 Exon enhancer AAGAAAAGGGA hTra2 , SRp55
R0887 Exon silencer TAGACA hnRNP A1
R0888 Exon enhancer GAAGAAGAA 9G8, SC35, ASF/SF2
R0889 Exon enhancer AGAGGAAGGCGA 9G8, SC35
R0890 Exon enhancer AGGAGCAGGGGACGAAG 9G8, SC35
R0891 Exon enhancer GAAGAAGA
R0892 Exon enhancer CAAGCATCAGCAAAAGCCAAAC
R0893 Exon enhancer TCCTACATCCT
R0894 Exon silencer TTAAACACAAGTT
R0895 Exon silencer TTTGAA hnRNP A/B
R0896 Exon silencer CTAGATATGGATCC
R0897 Exon silencer TTAG
R0898 Exon silencer CCAAGTCAAAATTTAC 37 Kd protein
R0899 Exon silencer TTAGGACGTATAGTTAGTCCTAGG hnRNP A/B
R0900 Exon silencer CCAATAGTAGTAGCGGGAGAATG ASF/SF2, SC35
R0901 Exon enhancer AAGTGTT Tra2beta/hnRNPG
R0902 Exon enhancer GAGGAAGAA SRp30a, SRp40,SRp55, SRp70
R0903 Exon enhancer TCGACATTGGGAGCAGTCGGCTCGTGC SRp40
R0904 Exon silencer TGTCTCTTCTTTGCTCGGCTCCCCCGCCTG
CGGTCCCATCAGAGCAG
U2AF(65), PTB, SR Proteins
R0905 Exon enhancer GAAGGACCTGAAGGACCCTGCAGGAAAAGC
CGAGCCAGCCCAGCC
R0906 Exon enhancer AAGTAACAA hnRNP G, Tra2�
R0907 Exon enhancer TTTTGCATGCTGAAACTTCTCAACCAGAAG
AAAGGGCCTTCACAGTGTCCTTTATGTAAG
AATGATATAACCAAAAG
SRp55
R0908 Exon enhancer AAGAAGC
R0909 Exon enhancer GATGAC SF2/ASF
R0910 Exon enhancer GHVVGANR TRA2 BETA1
R0911 Exon enhancer CACCACCACC YB-1
R0912 Exon silencer TCTTCTT U2AF, PTB
R0913 Exon silencer GGCTCCCCC SRp55, SRp30s
R0914 Exon silencer AGAGCAGG ASF/SF2
R0915 Exon silencer TGGT
R0916 Exon enhancer GAAGGA SRp75, SRp55, SRp30a
R0917 Exon enhancer GAAGAA SRp75, SRp55, SRp30a
R0918 Exon silencer AATGTG
R0919 Exon silencer TATTTATT
R0920 Exon silencer TTAAGGT
R0921 Exon silencer TGAGACC
R0922 Exon enhancer TCCTACATCCT
R0923 Exon silencer TTAAACACAAGTT
R0924 Exon enhancer CAGACAA SR protein
R0925 Exon enhancer CTGAGTT SR protein
R0926 Exon silencer AGATGCTG SR protein
R0927 Exon enhancer ATCAGGC
R0928 Exon enhancer AAGT hnRNPG
R0929 Exon enhancer GAGGAGAAG ASF/SF2
R0930 Exon enhancer GGAAAGTCTGATTGAAGAGGAAGCCAGGCA
GAAGAAGA
R0931 Exon enhancer GGAAAGTCTGATTGAAGAGGAAGCCAGGCA
GAAGAAGA
Tra2 alpha
R0932 Exon enhancer ATTAATGAAAAT
R0933 Exon enhancer CGCAGGC ASF/SF2, SC35
R0934 Exon enhancer GGACCCGCAGGCTGCAA SC35
R0935 Exon enhancer CAACAGCG SRp40
R0936 Exon enhancer CTCCAAGAAGAAGCCGCCAGCAACAAGCAA
GAAGGA
R0937 Exon silencer GAGATGTGATGAAGGAGATGGGAGG
R0938 Exon silencer AAGAGGAAGAATGGCTTGAGGAAGACGACG
R0939 Exon enhancer TCTCCTGCTTCCGGAAGGAC
R0940 Exon enhancer GAGAAAGGAGAGA
R0941 Exon silencer AGATCCTAGACTAGAGCCCT hnRNP A/B

Department of Biological Science and Technology, Institute of Bioinformatics, National Chiao Tung University, Taiwan
Contact with Dr. Hsien-Da Huang